Analysis of the state of immunity in patients with chronic gastritis infected with Helicobacter pylori

Cover Page

Cite item

Abstract

Helicobacter pylori is considered an etiological agent of chronic gastritis and a number of other diseases of the gastrointestinal tract. The immune response to H. pylori is characterized by the development of both pro-inflammatory and tolerogenic reactions. Against this background, the possibility of forming autoimmune shifts is also assumed. The purpose of the present study was to conduct a comparative analysis of the state of immunity in patients with chronic gastritis in the exacerbation stage associated with and not associated with H. pylori infection. There were used whole peripheral blood (n = 50) and serum (n = 49) samples from 162 patients with primary chronic gastritis at the exacerbation stage, in which the presence or absence of H. pylori DNA was tested by real-time PCR in gastric juice. In the peripheral blood of patients, the relative content of CD4+FoxP3+ cells (T regulators) and CD4+CD161+ cells (IL-17 producing cells) was evaluated using flow cytofluorometry and monoclonal antibodies method, the level of mRNA FoxP3 and mRNA IL-17A was determined using real time RT-PCR, and the concentration of IL-2 and IL-23 was determined using enzyme immunoassay. It has been shown that in H. pylori-infected patients with chronic gastritis in the exacerbation stage in comparison with patients not infected with H. pylori, the content of CD4+FoxP3+ cells, CD4+CD161+ cells does not change in the blood, also with the level of mRNA FoxP3 and mRNA IL-17A. Since the equilibrium between the populations of Th17 cells and T regulators is modulated by IL-2, which is important for generating the population of T regulators, but inhibits polarization of the immune response towards Th17 cells, we conducted a comparative assessment of the serum IL-2 level in patients with chronic gastritis. All patients showed an increase in IL-2 content in comparison with the norm. In this case, the concentration of IL-2 in the blood of infected H. pylori patients was statistically significantly higher than in H. pylori-uninfected patients. An important regulator of the function of Th17 cells is also IL-23, which induces the differentiation of naive T lymphocytes into Th17 cells involved in inflammatory and autoimmune reactions. In this regard, we determined the level of this cytokine in the blood of patients with chronic gastritis. Multiple increase of IL-23 concentration in comparison with normal level and higher content of IL-23 in H. pylori-infected patients in comparison with uninfected patients were revealed. On the basis of the obtained data, it can be concluded that an increase in the concentration of IL-23 does not exclude the possibility of forming autoimmune shifts with its participation in persons with helicobacter infection, but the issue requires further study.

Full Text

Введение

В настоящее время показана связь между инфицированием организма агентами бактериальной и вирусной природы и развитием аутоиммунных заболеваний разного характера. Стало очевидным, что эволюционные процессы могут стимулировать фиксацию генетических вариаций, которые увеличивают или уменьшают степень иммунологической защиты организма от инфекций, но также приводят к более высокому риску развития аутоиммунных заболеваний [11]. В группу инфекционных агентов, которые могут служить потенциальными факторами развития аутоиммунных заболеваний, включен Helicobacter pylori (H. pylori). Данный микроорганизм находится в центре пристального внимания с момента своего открытия в 1982 г. Он встречается у более чем 60% населения планеты. В настоящее время его считают основным этиологическим фактором гастрита и язвенной болезни, а также фактором, вовлеченным в генез рака и лимфомы желудка MALT-типа [12, 19]. Характерной особенностью хеликобактерной инфекции является то, что у значительного процента зараженных она протекает практически бессимптомно, что, несомненно, сильно затрудняет ее идентификацию [9]. Одним из факторов, влияющих на подобное положение вещей, считают способность H. pylori воздействовать на иммунный ответ хозяина, направляя его в сторону усиления толерогенных процессов [5]. На фоне толерогенного действия показана возможность влиять на развитие аутоиммунных и аллергических заболеваний [8, 17, 21, 31]. Таким образом существует достаточно сложная и неоднозначная картина влияния H. pylori на иммунологические процессы организма, в том числе на состояние иммунитета и цитокинового статуса у больных хроническим гастритом. Цель настоящей работы — проведение сравнительного анализа состояния иммунитета у больных с хроническим гастритом в стадии обострения, ассоциированным и не ассоциированным с инфицированием H. pylori.

Материалы и методы

Исследование проводили согласно биоэтическим и этическим принципам, установленным Хельсинкской декларацией, принятой в июне 1964 г. (г. Хельсинки, Финляндия) и пересмотренной в октябре 2013 г. (г. Форталеза, Бразилия). В соответствии со статьей 24 Конституции РФ и Хельсинкской декларацией (1964 г.) все пациенты дали информированное согласие на использование биологического материала в научном исследовании. Проведение данного исследования одобрено локальным комитетом по этике ФБУН ННИИЭМ им. академика И.Н. Блохиной Роспотребнадзора (протокол № 6 от 25.11.2021). В работе использовали образцы цельной периферической крови (n = 50) и плазмы крови (n = 49) больных с впервые выявленным хроническим гастритом в стадии обострения, проходивших лечение в клинике инфекционных болезней ФБУН ННИИЭМ им. академика И.Н. Блохиной Роспотребнадзора. Диагноз «хронический гастрит» подтверждали проводимым алгоритмом исследования с детализацией жалоб и времени их появления, проведением эзофагогастродуоденоскопии (ЭГДС) с забором биопсии слизистой оболочки из антрального отдела и тела желудка, морфологическим исследованием биоптатов слизистой. При выполнении исследования в серии предварительных наблюдений было проведено сопоставление результатов ПЦР (определение ДНК H. pylori в желудочном соке) с анализом обсемененности образцов биопсии слизистой антрального отдела и тела желудка H. pylori, а также сопоставление результатов ПЦР с выделением H. pylori в культуру и анализом образцов с помощью MALDI-TOF спектрометрии с использованием аппарата Autoflex Speed LRF (Bruker Daltonics, Германия). Во всех случаях было обнаружено полное совпадение результатов ПЦР, анализа биопсии и результатов спектрометрии. В связи с этим в дальнейшей работе мы использовали только определение ДНК H. pylori в желудочном соке методом ПЦР в реальном времени с использованием набора «РеалБест ДНК Helicobacter pylori» производства «Вектор-Бест», Россия.

В первую группу вошли лица с гастритами (n = 26), ассоциированными с H. pylori, а во вторую — с гастритами, не связанными с инфекцией H. pylori (n = 24).

Периферическую кровь забирали в объеме 10 мл в вакуумные пробирки с динатриевой солью этилендиаминтетраацетата (ЭДТА) (Vacuette, Германия) и использовали в дальнейшем исследовании.

Из образцов цельной периферической крови выделяли лейкоцитарную фракцию клеток. В отдельной пробирке смешивали 1 мл крови и 10 мл раствора для лизиса эритроцитов (1x Red Blood Cell (1х RBC) Lysis Buffer, eBioscience, США), аккуратно перемешивали и инкубировали 10 минут при комнатной температуре. Лейкоциты осаждали центрифугированием 5 минут (400g, 2–8°С) и промывали 0,9% NaCl. Лейкоциты ресуспендировали в 400 мкл буфера для цитометрии (Flow Cytometry Staining Buffer Solution, eBioscience, США). Для фенотипирования Тh17 проводили поверхностное окрашивание моноклональными антителами Anti-Human СD4-FITC, Anti-Human CD161-PE (eBioscience, США). Для фенотипирования Т-регуляторных лимфоцитов клетки окрашивали моноклональными антителами Anti-Human СD4-FITC (eBioscience, США), фиксировали и пермеабилизировали соответствующим набором буферных растворов (Fixation/Permeabilization Diluent, Permeabilization Buffer 10X, eBioscience, США) и добавляли моноклональные антитела Anti-Human FoxP3-РE (eBioscience, США). Клетки анализировали на проточном цитофлуориметре CytoFLEX (Beckman Coulter, США). Использовали программное обеспечение CytExpert (Beckman Coulter, США). Т-хелперы 17 типа (Th17) и T-регуляторы (Treg) определяли как клетки фенотипа CD4+CD161+ и клетки фенотипа CD4+FoxP3+ соответственно [10, 11].

Содержание цитокинов IL-2 и IL-23 определяли в плазме крови с помощью иммуноферментных наборов Интерлейкин-2-ИФА-БЕСТ (Вектор-Бест, Россия) и Human IL-23 Platinum ELISA (eBioscience, США). При анализе результатов в качестве нормы использовали данные производителей наборов и результаты, представленные в работах других авторов. За норму принимали концентрацию IL-2 не выше 10 пг/мл [2], концентрацию IL-23 не выше 40 пг/мл [30].

Относительный уровень мРНК IL-17А и FoxP3 определяли в периферической крови методом ОТ-ПЦР в реальном времени. Для этого из 200 мкл периферической крови выделяли нуклеиновую кислоту с использованием набора «РИБО-преп» (Интерлабсервис, Россия) и инкубировали с DNase I RNase-free (Fermentas, ЕС) для удаления ДНК, согласно рекомендациям производителей. Полученный препарат РНК использовали в реакции обратной транскрипции с использованием статистических затравок и M-MLV RT (Invitogen, США). С полученной комплементарной ДНК проводили дуплексную полимеразную цепную реакцию в реальном времени. Реакционная смесь содержала 20 mMTris-HClpH 8.4, 50 mMKCl, 1,5 мМ MgCl2, 0,4 мМдНТФ, по 10 пг прямого, обратного праймеров и флуоресцентно меченных зондов, 5 единиц активности полимеразы TaqF (Амплисенс, Россия) и 2 мкл комплементарной ДНК. Реакцию проводили в амплификаторе DTprime5 (ООО «ДНК-Технология, Россия) при следующих температурных условиях: 94°С – 10 мин, 45 циклов амплификации (94°С — 30 с, 55°С — 30 с, 72°С — 30 с). Первичная структура используемых праймеров и зондов представлена в табл.

 

Таблица. Первичная структура олигонуклеотидов

Table. Primary structure of oligonucleotides

мРНК

mRNA

Праймер

Primer

Первичная структура (5′→3′)

Primary structure (5′→3′)

IL-17

прямой/forward

TCTGTGATCTGGGAGGCAAAGT

обратный/reverse

GGAGTTGGGGCAGTGTGGAG

зонд/probe

ROX-TGGGAACGTGGACTACCACATGAACTCT-BHQ-2

FoxP3

прямой/forward

GAGAAGCTGAGTGCCATGCA

обратный/reverse

GGAGCCCTTGTCGGATGAT

зонд/probe

FAM-TGCCATTTTCCCAGCCAGGTGG-BHQ-1

YWHAZ

прямой/forward

TGCAATGATGTACTGTCTCT

обратный/reverse

ACTGATCGACAATCCCTTTC

зонд/probe

Cy5-ATTACTACCGTTACTTGGCTGAGGTTGCC-BHQ-2

 

Уровень исследуемой мРНК (Х) рассчитывали относительно мРНК референсного гена (N) с использованием значений пороговых циклов амплификации Ct по формуле: 2–(CtN-CtX).

Статистическую обработку полученных результатов проводили с помощью компьютерной программы GraphPad Prism 8 (GraphPad Software, США). Исследованные количественные показатели представлены в виде Me (25–75%), где Me — медиана, 25% — нижний квартиль, 75% — верхний квартиль. Для сопоставления двух независимых групп использовали двусторонний U-критерий Манна–Уитни, предварительно проведя проверку на нормальное распределение значений. Корреляционный анализ проводили методом ранговой корреляции Спирмена. Различия между группами полагали статистически значимыми при p ≤ 0,05.

Результаты

В крови больных хроническим гастритом проанализировано содержание клеток фенотипа CD4+FoxP3+ от всех СD4+ Т-лимфоцитов. Обнаружено, что у пациентов, положительных по H. pylori, медиана содержания клеток фенотипа CD4+FoxP3+ составила 2,37 (1,52–4,45)%. В то же время у пациентов с отсутствием хеликобактерной инфекции этот показатель составил 2,31 (1,92–5,58)% (рис. 1). Количество клеток фенотипа CD4+FoxP3+ у пациентов с наличием H. pylori статистически значимо не отличалось от такового у пациентов, у которых H. pylori не было выявлено.

 

Рисунок 1. Содержание клеток CD4+FoxP3+ в периферической крови больных хроническим гастритом, инфицированных (+) и не инфицированных (–) H. pylori (% от CD4+ Т-лимфоцитов)

Figure 1. The content of CD4+FoxP3+ cells in the peripheral blood of patients with chronic gastritis infected (+) and not infected (–) with H. pylori (% от CD4+ Т cells)

 

С помощью ОТ-ПЦР в реальном времени был определен относительный уровень мРНК гена, кодирующего FoxP3. Статистически значимых различий в экспрессии гена FoxP3 у больных, инфицированных и не инфицированных H. pylori, обнаружено не было, что соответствует результатам цитофлуориметрического анализа (рис. 2).

 

Рисунок 2. Уровень мРНК FoxP3 относительно мРНК YWHAZ в периферической крови больных хроническим гастритом, инфицированных (+) и не инфицированных (–) H. pylori

Figure 2. The level of FoxP3 mRNA relative to YWHAZ mRNA in the peripheral blood of patients with chronic gastritis infected (+) and not infected (–) with H. pylori

 

Цитофлуориметрический анализ популяций CD4+ клеток показал, что относительное содержание Т-лимфоцитов фенотипа CD4+CD161+ у положительных по Н. pylori пациентов с обострением хронического гастрита статистически значимо не отличалось от количества CD4+CD161+ клеток у больных хроническим гастритом в стадии обострения, но не инфицированных Н. pylori. Медиана содержания Т-лимфоцитов фенотипа CD4+CD161+ у пациентов с положительным тестом на H. pylori составила 9.94 (8,89–12,36)% от всех CD4+ клеток, у пациентов, негативных по H. pylori, — 10,84 (8,74–14,40)% от всех CD4+ клеток (рис. 3).

 

Рисунок 3. Содержание клеток CD4+CD161+ в периферической крови больных хроническим гастритом, инфицированных (+) и не инфицированных (–) H. pylori (% от CD4+ Т-лимфоцитов)

Figure 3. The content of CD4+CD161+ cells in the peripheral blood of patients with chronic gastritis infected (+) and not infected (–) with H. pylori (% от CD4+ Т cells)

 

Наряду с цитофлуориметрическим анализом содержания CD4+CD161+ клеток в крови больных хроническим гастритом был определен относительный уровень мРНК IL-17A (рис. 4). В крови больных, инфицированных H. pylori, как и в крови больных, отрицательных по этому показателю, содержание мРНК IL-17A статистически значимо не различалось, что соответствует полученным данным по содержанию CD4+CD161+ клеток.

 

Рисунок 4. Уровень мРНК IL-17A относительно мРНК YWHAZ в периферической крови больных хроническим гастритом, инфицированных (+) и не инфицированных (–) H. pylori

Figure 4. The level of IL-17A mRNA relative to YWHAZ mRNA in the peripheral blood of patients with chronic gastritis infected (+) and not infected (–) with H. pylori

 

В сыворотке крови больных хроническим гастритом в стадии обострения был определен уровень цитокинов IL-2 и IL-23. Медиана концентрации IL-2 у пациентов, положительных по H. pylori, составила 18,51 (17,67–19,34) пг/мл, у отрицательных — 16,84 (16,21–17,28) пг/мл (рис. 5). В сыворотке крови пациентов, инфицированных H. pylori, выявлено статистически значимое повышение уровня IL-2 в сравнении с группой пациентов, не инфицированных H. pylori (p < 0,0001).

 

Рисунок 5. Содержание IL-2 в сыворотке крови больных хроническим гастритом, инфицированных (+) и не инфицированных (–) H. pylori

Figure 5. The content of IL-2 in the blood serum of patients with chronic gastritis infected (+) and not infected (–) with H. pylori

Примечание. p ≤ 0,001 достоверные отличия при p ≤ 0,05.

Note. p ≤ 0.001 significant differences at p ≤ 0.05.

 

У отрицательных по H. pylori пациентов медиана концентрации IL-23 составила 294,8 [259, 1–362, 9] пг/мл. В то же время у положительных по H. pylori пациентов она была статистически значимо выше и составила 419,8 [324, 2–625, 4] пг/мл (р = 0,0008) (рис. 6). В обоих случаях уровень IL-23 многократно превышал показатели нормы.

 

Рисунок 6. Содержание IL-23 в сыворотке крови больных хроническим гастритом, инфицированных (+) и не инфицированных (–) H. pylori

Figure 6. The content of IL-23 in the blood serum of patients with chronic gastritis infected (+) and not infected (–) with H. pylori

 

Обсуждение

В настоящее время хорошо известно, что Т-клетки, продуцирующие IL-17 и IFNγ, играют решающую роль в иммунитете против H. pylori, а регуляторные Т-клетки способны подавлять эти Т-клеточные функции и обладают толерогенным действием [16]. У инфицированных H. pylori пациентов в слизистой желудка обнаружено повышенное содержание Т-регуляторов, которое положительно коррелирует с тяжестью хронического гастрита [15]. Ранее нами была проведена оценка способности H. pylori модулировать дифференцирующее действие на Т-лимфоциты при прямом контакте в условиях in vitro, что оценивалось по изменению содержания в культуре T-регуляторов фенотипа CD4+CD25+FoxP3+. Было показано, что при прямом контакте с H. pylori количество Т-регуляторов увеличивается в 2,5 раза. Одновременно регистрировалось многократное повышение продукции Т-клетками IL-10 [1].

Представлены сообщения о локальных изменениях количества Т-регуляторов в слизистой оболочке желудка и об увеличении их количества в периферической крови больных с инфекцией CagA+ H. pylori, которое определялось по уровню CD4+CD25+hi клеток. Однако, в крови больных с CagA H. pylori инфекцией уровень CD4+CD25+hi клеток оставался соответствующим норме [29]. В исследовании К. Hussain и соавт. показано, что содержание FoxP3+ клеток среди CD4+CD25+hi клеток периферической крови и уровень мРНК FoxP3 не различались у инфицированных и неинфицированных H. pylori доноров [14], что соответствует полученным нами данным об отсутствии различий между инфицированными и не инфицированными H. pylori больными хроническим гастритом, содержании в периферической крови CD4+FoxP3+ Т-клеток и мРНК FoxP3.

Наряду с оценкой влияния H. pylori на популяцию T-регуляторов в условиях in vitro ранее нами была проведена также оценка влияния H. pylori на популяции CD4+CD161+ Т-клеток, которые являются IL-17-продуцирующими клетками и перекрываются с популяцией Th17-клеток, играющей важную роль в развитии иммунного ответа на H. pylori. Было показано, что при прямом контакте с H. pylori содержание CD4+CD161+ Т-лимфоцитов не изменяется на фоне многократного повышения концентрации INFγ [3]. В то же время имеются сообщения о повышении уровня Th17-клеток, продуцирующих IL-17 в слизистой желудка инфицированных H. pylori лиц [10].

По данным литературы, количество Th17-клеток в крови здоровых доноров составляет 6–7% от всех CD4+ клеток [20, 27]. Содержание Т-клеток фенотипа CD4+CD161+ у тестированных больных обеих групп превышало представленные в литературе контрольные показатели CD4+CD161+ клеток в крови здоровых доноров.

Молекула CD161, известная как молекула, относящаяся к лектиноподобным рецепторам натуральных киллеров, участвует в клеточной передаче сигналов и активации клеток. Имеются противоречивые данные о специфичности этой молекулы по отношению к Th17-клеткам, поскольку она экспрессируется в различной степени на многих других популяциях Т-клеток, включая наивные Т-клетки, CD4+ Т-клетки памяти, Th2 и Т-регуляторные клетки [4, 22, 25].

Определение мРНК IL-17А, продукция которого характерна для Th17-клеток, также не обнаружило различий между инфицированными H. pylori и не инфицированными H. pylori больными. Известно несколько изоформ IL-17, самыми распространенными из которых являются IL-17A и IL-17C. В слизистой желудка больных с хеликобактерной инфекцией недавно был обнаружен повышенный уровень мРНК IL-17С, уровень IL-17А не менялся в ответ на инфицирование H. pylori [28]. Однако существуют и противоположные данные, свидетельствующие о повышении и понижении экспрессии мРНК IL-17 в слизистой разных отделов желудка при хеликобактерной инфекции [24]. Данных о содержании IL-17A в крови при хеликобактерной инфекции в доступной литературе нами не обнаружено.

Таким образом, полученные в рамках настоящей работы результаты свидетельствуют об отсутствии на системном уровне изменений в содержании регуляторных CD4+FoxP3+ клеток, мРНК FoxP3, мРНК IL-17A и близкой к Th17 популяции CD4+CD161+ T-клеток у инфицированных H. pylori больных хроническим гастритом.

Известно, что равновесие между популяциями Тh17-клеток и Тreg модулируется IL-2, который важен для генерации популяции Т-регуляторов, но ингибирует поляризацию иммунного ответа в сторону Th17-клеток. Делеции в гене, кодирующем IL-2, блокада антителами против IL-2, разрушение сигнальных путей транскрипционного фактора STAT5 приводит к дифференцировке в сторону популяции Th17-клеток [18]. Мы оценили уровень IL-2 в крови больных хроническим гастритом в стадии обострения. Обнаружено повышение сывороточного содержания IL-2 в крови, инфицированных H. pylori лиц, что, вероятно, является свидетельством смещения равновесия популяций Т-клеток в сторону Тreg и объясняет не только отсутствие повышенного содержания у инфицированных H. pylori больных уровня CD4+CD161+ T-клеток, но также отсутствие различий в содержании мРНК IL-17А.

Еще одним важным регулятором функции Th17-клеток является IL-23, основная роль которого — индукция дифференцировки наивных Т-лимфоцитов в Th1- и Тh17-клетки, принимающие участие в воспалительных и аутоиммунных реакциях [26]. Интерлейкин-23 (IL-23) относится к семейству IL-12. Показано, что IL-23 повышает секрецию IL-17, в то время как IL-12 опосредует специфическое ингибирование продукции IL-17. Считается, что за счет этого IL-23 играет роль провоспалительного цитокина, стимулируя продукцию Т-лимфоцитами IL-17 [22]. IL-23 может выступать в качестве промотора аутоиммунного воспаления, в отличие от IL-12, который парадоксальным образом обеспечивает защиту от аутоиммунного воспаления [23]. Нами получены данные о многократном повышении уровня IL-23 в крови больных хроническим гастритом, что отражает наличие воспалительных процессов, сопровождающих течение острой фазы заболевания. Кроме того, получены данные о статистически значимом подъеме содержания IL-23 в крови инфицированных H. pylori больных в сравнении с больными, у которых H. pylori не был выявлен. Это указывает как на провоспалительное действие IL-23, развивающееся при обострении хронического гастрита, так и на возможную провокацию этим цитокином аутоиммунных реакций. Показано, что слизистыми поверхностями инфицированных H. pylori лиц продуцируется повышенное количество IL-23, которое поддерживает продукцию IL-17, результатом чего является стимуляция воспаления [6, 7]. Известно, что повышенное содержание IL-23 ассоциируется с некоторыми аутоиммунными заболеваниями, такими как ревматоидный артрит и множественный склероз [30]. Полученные нами результаты не исключают возможного участия IL-23 в формировании аутоиммунных сдвигов у лиц с хеликобактерной инфекцией, однако этот вопрос требует дальнейшего изучения.

×

About the authors

Ekaterina V. Mokhonova

I.N. Blokhina Nizhny Novgorod Scientific and Research Institute of Epidemiology and Microbiology of the Russian Federal Service for Surveillance on Consumer Rights Protection and Human Wellbeing (Rospotrebnadzor)

Email: ekaterinamohonova@yandex.ru
ORCID iD: 0000-0002-9742-7646

Researcher, Immune Chemistry Laboratory, I.N. Blokhina Nizhny Novgorod Scientific and Research Institute of Epidemiology and Microbiology of the Rospotrebnadzor

Russian Federation, 603950, Nizhniy Novgorod, Malaya Yamskaya str., 71

V. A. Lapin

I.N. Blokhina Nizhny Novgorod Scientific and Research Institute of Epidemiology and Microbiology of the Russian Federal Service for Surveillance on Consumer Rights Protection and Human Wellbeing (Rospotrebnadzor)

Email: fridens.95@yandex.ru
ORCID iD: 0000-0002-5905-5722

Junior Researcher, Immune Chemistry Laboratory

Russian Federation, 603950, Nizhniy Novgorod, Malaya Yamskaya str., 71

D. A. Melentiev

I.N. Blokhina Nizhny Novgorod Scientific and Research Institute of Epidemiology and Microbiology of the Russian Federal Service for Surveillance on Consumer Rights Protection and Human Wellbeing (Rospotrebnadzor)

Email: dim-melente@yandex.ru
ORCID iD: 0000-0002-2441-6874

Junior Researcher, Immune Chemistry Laboratory

Russian Federation, 603950, Nizhniy Novgorod, Malaya Yamskaya str., 71

D. V. Novikov

I.N. Blokhina Nizhny Novgorod Scientific and Research Institute of Epidemiology and Microbiology of the Russian Federal Service for Surveillance on Consumer Rights Protection and Human Wellbeing (Rospotrebnadzor)

Email: novikov.dv75@mail.ru
ORCID iD: 0000-0001-7049-6935

PhD (Biology), Associate Professor, Leading Researcher, Immune Chemistry Laboratory

Russian Federation, 603950, Nizhniy Novgorod, Malaya Yamskaya str., 71

N. V. Neumoina

I.N. Blokhina Nizhny Novgorod Scientific and Research Institute of Epidemiology and Microbiology of the Russian Federal Service for Surveillance on Consumer Rights Protection and Human Wellbeing (Rospotrebnadzor)

Email: tak1510@yandex.ru
ORCID iD: 0000-0002-1394-3484

PhD (Medicine), Head Physician of the Infectious Diseases Clinic

Russian Federation, 603950, Nizhniy Novgorod, Malaya Yamskaya str., 71

K. M. Perfilova

I.N. Blokhina Nizhny Novgorod Scientific and Research Institute of Epidemiology and Microbiology of the Russian Federal Service for Surveillance on Consumer Rights Protection and Human Wellbeing (Rospotrebnadzor)

Email: kperfilova@yandex.ru
ORCID iD: 0000-0001-6395-9014

PhD (Medicine), Deputy Head Physician of the Infectious Diseases Clinic

Russian Federation, 603950, Nizhniy Novgorod, Malaya Yamskaya str., 71

M. V. Neumoina

I.N. Blokhina Nizhny Novgorod Scientific and Research Institute of Epidemiology and Microbiology of the Russian Federal Service for Surveillance on Consumer Rights Protection and Human Wellbeing (Rospotrebnadzor)

Email: tak1510@yandex.ru
ORCID iD: 0000-0003-0153-3573

PhD (Medicine), Head of the Department of Patient Consultation and Admission, Infectious Diseases Clinic

Russian Federation, 603950, Nizhniy Novgorod, Malaya Yamskaya str., 71

T. A. Troshina

I.N. Blokhina Nizhny Novgorod Scientific and Research Institute of Epidemiology and Microbiology of the Russian Federal Service for Surveillance on Consumer Rights Protection and Human Wellbeing (Rospotrebnadzor)

Email: tak1510@yandex.ru
ORCID iD: 0000-0002-3724-4258

Head of the Third Infection Diseases Department, Infectious Diseases Clinic

Russian Federation, 603950, Nizhniy Novgorod, Malaya Yamskaya str., 71

I. V. Shutova

I.N. Blokhina Nizhny Novgorod Scientific and Research Institute of Epidemiology and Microbiology of the Russian Federal Service for Surveillance on Consumer Rights Protection and Human Wellbeing (Rospotrebnadzor)

Email: tak1510@yandex.ru
ORCID iD: 0000-0002-7073-9113

PhD (Medicine), Head of the Second Infection Diseases Department, Infectious Diseases Clinic

Russian Federation, 603950, Nizhniy Novgorod, Malaya Yamskaya str., 71

V. V. Novikov

I.N. Blokhina Nizhny Novgorod Scientific and Research Institute of Epidemiology and Microbiology of the Russian Federal Service for Surveillance on Consumer Rights Protection and Human Wellbeing (Rospotrebnadzor)

Author for correspondence.
Email: mbre@mail.ru
ORCID iD: 0000-0002-2449-7213

PhD, MD (Biology), Professor, Head of the Immune Chemistry Laboratory

Russian Federation, 603950, Nizhniy Novgorod, Malaya Yamskaya str., 71

References

  1. Матвеичев А.В., Талаева М.В., Талаев В.Ю., Неумоина Н.В., Перфилова К.М., Лапаев Д.Г., Мохонова Е.В., Цыганова М.И., Коптелова В.Н., Никитина З.И., Лапин В.А., Мелентьев Д.А. Влияние Helicobacter pylori на дифференцировку Т-регуляторных клеток // Анализ риска здоровью. 2017. № 1. С. 21–28. [Matveichev А.V., Talaeva М.V., Talaev V.Yu., Neumoina N.V., Perfilova K.M., Lapaev D.G., Mokhonova E.V., Tsyganova M.I., Koptelova V.N., Nikitina Z.I., Lapin V.A., Melentiev D.A. Influence exerted by Helicobacter pylori on regulatory T-cells differentiation. Analiz riska zdoroviyu = Health Risk Analysis, 2017, no. 1, pp. 21–28. (In Russ.)] doi: 10.21668/health.risk/2017.1.03.eng
  2. Синяков А.А., Cмирнова О.В., Каспаров Э.В. Показатели некоторых цитокинов у больных хроническим, хроническим атрофическим гастритом на фоне Helicobacter pylori-инфекции // Сибирский журнал естественных наук и сельского хозяйства. 2019. Т. 11, № 5–2. С. 124–128. [Sinyakov A.A., Smirnova O.V., Kasparov E.V. Indicators of some cytokines in patients with chronic, chronic atrophic gastritis with Helicobacter pylori infection. Sibirskiy zhurnal estestvennykh nauk i sel’skogo khozyaystva = Siberian Journal of Life Sciences and Agriculture, 2019, vol. 11, no. 5–2, pp. 124–128. (In Russ.)] doi: 10.12731/2658-6649-2019-11-5-2-124-128
  3. Цыганова М.И., Талаева М.В., Талаев В.Ю., Неумоина Н.В., Перфилова К.М., Мохонова E.B., Лапин В.А., Мелентьев Д.А. Влияние Helicobacter pylori на содержание провоспалительных Т-клеточных цитокинов и продуцирующих их субпопуляций // Анализ риска здоровью. 2018. № 3. С. 120–127. [Tsyganova M.I., Talaeva M.V., Talaev V.Yu., Neumoina N.V., Perfilova K.M., Mokhonova E.V., Lapin V.A., Melentiev D.A. Influence exerted by Helicobacter pylori on concentrations of anti-inflammatory T-cell cytokines and sunpopulations that produce them. Analiz riska zdorov’yu = Health Risk Analysis, 2018, no. 3, pp. 120–127. (In Russ.)] doi: 10.21668/health.risk/2018.3.13.eng
  4. Afzali B., Mitchell P.J., Edozie F.C., Povoleri G.A.M., Dowson S.E., Demandt L., Walter G., Canavan J.B., Scotta C., Menon B., Chana P.S., Khamri W., Kordasti S., Heck S., Grimbacher B., Tree T., Cope A.P., Taams L.S., Lechler R.I., John S., Lombardi G. CD161 expression characterizes a subpopulation of human regulatory T cells that produces IL-17 in a STAT3-dependent manner. Eur. J. Immunol., 2013, vol. 43, no. 8, pp. 2043–2054. doi: 10.1002/eji.201243296
  5. Altobelli A., Bauer M., Velez K., Cover T.L., Müller A. Helicobacter pylori VacA targets myeloid cells in the gastric lamina propria to promote peripherally induced regulatory T-cell differentiation and persistent infection. mBio, 2019, vol. 10, no. 2: e00261-19. doi: 10.1128/mBio.00261-19
  6. Caruso R., Fina D., Paoluzi O.A., Blanco G.D.V., Stolfi C., Rizzo A., Caprioli F., Sarra M., Andrei F., Fantini M.C., MacDonald T.T., Pallone F., Monteleone G. IL-23-mediated regulation of IL-17 production in Helicobacter pylori-infected gastric mucosa. Eur. J. Immunol., 2008, vol. 38, no. 2, pp. 470–478. doi: 10.1002/eji.200737635
  7. Caruso R., Pallone F., Monteleone G. Emerging role of IL-23/IL-17 axis in H. pylori-associated pathology. World J. Gastroenterol., 2007, vol. 13, no. 42, pp. 5547–5551. doi: 10.3748/wjg.v13.i42.5547
  8. Chmiela M., Gonciarz W. Molecular mimicry in Helicobacter pylori infections. World J. Gastroenterol., 2017, vol. 23, no. 22, pp. 3964–3977. doi: 10.3748/wjg.v23.i22.3964
  9. Chojnacki C., Popławski T., Błońska A., Błasiak J., Romanowski M., Chojnacki J. Expression of tryptophan hydroxylase in gastric mucosa in symptomatic and asymptomatic Helicobacter pylori infection. Arch. Med. Sci., 2019, vol. 15, no. 2, pp. 416–423. doi: 10.5114/aoms.2018.76928
  10. Dixon B.R.E.A., Hossain R., Patel R.V., Algood H.M.C. Th17 Cells in Helicobacter pylori infection: a dichotomy of help and harm. Infect. Immun., 2019, vol. 87, no 11: e00363-19. doi: 10.1128/IAI.00363-19
  11. Dominguez-Andres J., Netea M.G. Impact of historic migrations and evolutionary processes on human immunity. Trends Immunol., 2019, vol. 40, no. 12, pp. 1105–1119. doi: 10.1016/j.it.2019.10.001
  12. FitzGerald R., Smith S.M. An overview of Helicobacter pylori infection. Methods Mol. Biol., 2021, vol. 2283, pp 1–14. doi: 10.1007/978-1-0716-1302-3_1
  13. Hoeve M.A., Savage N.D.L., de Boer T., Langenberg D.M.L., de Waal Malefyt R., Ottenhoff T.H.M., Verreck F.A.W. Divergent effects of IL-12 and IL-23 on the production of IL-17 by human T cells. Eur. J. Immunol., 2006, vol. 36, no. 3, pp. 661–670. doi: 10.1002/eji.200535239
  14. Hussain K., Letley D.P., Greenaway A.B., Kenefeck R., Winter J.A., Tomlinson W., Rhead J., Staples E., Kaneko K., Atherton J.C., Robinson K. Helicobacter pylori-mediated protection from allergy is associated with IL-10-secreting peripheral blood regulatory T cells. Front. Immunol., 2016, vol. 7: 71. doi: 10.3389/fimmu.2016.00071
  15. Jang T.J. The number of Foxp3-positive regulatory T-cells is increased in Helicobacter pylori gastritis and gastric cancer. Pathol. Res. Pract., 2010, vol. 206, no. 1, pp. 34–38. doi: 10.1016/j.prp.2009.07.019
  16. Kandulski А., Malfertheiner Р., Wex Т. Role of regulatory T-cells in H. pylori-induced gastritis and gastric cancer. Anticancer Res., 2010, vol. 30, no. 4, pp. 1093–1103.
  17. Lankarani K.B., Honarvar B., Athari S.S. The mechanisms underlying Helicobacter pylori-mediated protection against allergic asthma. Tanaffos, 2017, vol. 16, no. 4, pp. 251–259.
  18. Laurence A., Tato C. M., Davidson T.S., Kanno Y., Chen Z., Yao Z., Blank R.B., Meylan F., Siegel R., Hennighausen L., Shevach E.M., O'Shea J.J. Interleukin-2 signaling via STAT5 constrains T helper 17 cell generation. Immunity, 2007, vol. 26, no. 3, pp. 371–381. doi: 10.1016/j.immuni.2007.02.009
  19. Leja M., Axon A., Brenner H. Epidemiology of Helicobacter pylori infection. Helicobacter, 2016, vol. 21, no. 1, pp. 3–7. doi: 10.1111/hel.12332
  20. Li L., He J., Zhu L., Yang J.Y., Jia R., Liu X., Liu Y., Sun X., Li Z. The clinical relevance of IL-17-producing CD4+ CD161+ cell and its subpopulations in primary Sjögren’s Syndrome. J. Immunol. Res., 2015: 307453. doi: 10.1155/2015/307453
  21. Magen E., Delgado J.-S. Helicobacter pylori and skin autoimmune diseases. World J. Gastroenterol., 2014, vol. 20, no. 6, pp. 1510–1516. doi: 10.3748/wjg.v20.i6.1510
  22. Maggi L., Santarlasci V., Capone M., Peired A., Frosali F., Crome S.Q., Querci V., Fambrini M., Liotta F., Levings M.K., Maggi E., Cosmi L., Romagnani S., Annunziato F. CD161 is a marker of all human IL-17-producing T-cell subsets and is induced by RORC. Eur. J. Immunol., 2010, vol. 40, no. 8, pp. 2174–2181. doi: 10.1002/eji.200940257
  23. Murphy C.A., Langrish C.L., Chen Y., Blumenschein W., McClanahan T., Kastelein R.A., Sedgwick J.D., Cua D.J. Divergent pro- and antiinflammatory roles for IL-23 and IL-12 in joint autoimmune inflammation. J. Exp. Med., 2003, vol. 198, no. 12, pp. 1951–1957. doi: 10.1084/jem.20030896
  24. Outlioua A., Badre W., Desterke C., Echarki Z., El Hammani N., Rabhi M., Riyad M., Karkouri M., Arnoult D., Khalil A., Akarid K. Gastric IL-1β, IL-8, and IL-17A expression in Moroccan patients infected with Helicobacter pylori may be a predictive signature of severe pathological stages. Cytokine, 2020, vol. 126: 154893. doi: 10.1016/j.cyto.2019.154893
  25. Ramesh R., Kozhaya L., McKevitt K., Djuretic I.M., Carlson T.J., Quintero M.A., McCauley J.L., Abreu M.T., Unutmaz D., Sundrud M.S. Pro-inflammatory human Th17 cells selectively express P-glycoprotein and are refractory to glucocorticoids. J. Exp. Med., 2014, vol. 211, no. 1, pp. 89–104. doi: 10.1084/jem.20130301
  26. Schinocca C., Rizzo C., Fasano S., Grasso G., Barbera L.L., Ciccia F., Guggino G. Role of the IL-23/IL-17 pathway in rheumatic diseases: an overview. Front. Immunol., 2021, vol. 12: 637829. doi: 10.3389/fimmu.2021.637829
  27. Shen H., Goodall J.C., Gaston J.S.H. Frequency and phenotype of peripheral blood Th17 cells in ankylosing spondylitis and rheumatoid arthritis. Arthritis Rheum., 2009, vol. 60, no. 6, pp. 1647–1656. doi: 10.1002/art.24568
  28. Tanaka S., Nagashima H., Cruz M., Uchida T., Uotani T., Abreu J.A.J., Mahachai V., Vilaichone R., Ratanachuek T., Tshering L., Graham D.Y., Graham D.Y., Yamaoka Y. Interleukin-17C in human Helicobacter pylori gastritis. Infect. Immun., 2017, vol. 85, no. 10: e00389-17. doi: 10.1128/IAI.00389-17
  29. Wang S.K., Zhu H.F., He B.S., Zhang Z.Y., Chen Z.T., Wang Z.Z., Wu G.L. CagA+ H. pylori infection is associated with polarization of T helper cell immune responses in gastric carcinogenesis. World J. Gastroenterol., 2007, vol. 13, no. 21, pp. 2923–2931. doi: 10.3748/wjg.v13.i21.2923
  30. Zaky D.S.E., El-Nahrery E.M.A. Role of interleukin-23 as a biomarker in rheumatoid arthritis patients and its correlation with disease activity. Int. Immunopharmacol., 2016, vol. 31, pp. 105–108. doi: 10.1016/j.intimp.2015.12.011
  31. Zuo Z.T., Ma Y., Sun Y., Bai C.Q., Ling C.H., Yuan F.L. The protective effects of Helicobacter pylori infection on allergic asthma. Int. Arch. Allergy Immunol., 2021, vol. 182, no. 1, pp. 53–64. doi: 10.1159/000508330

Supplementary files

Supplementary Files
Action
1. Figure 1. The content of CD4+FoxP3+ cells in the peripheral blood of patients with chronic gastritis infected (+) and not infected (–) with H. pylori (% от CD4+ Т cells)

Download (57KB)
2. Figure 2. The level of FoxP3 mRNA relative to YWHAZ mRNA in the peripheral blood of patients with chronic gastritis infected (+) and not infected (–) with H. pylori

Download (62KB)
3. Figure 3. The content of CD4+CD161+ cells in the peripheral blood of patients with chronic gastritis infected (+) and not infected (–) with H. pylori (% от CD4+ Т cells)

Download (56KB)
4. Figure 4. The level of IL-17A mRNA relative to YWHAZ mRNA in the peripheral blood of patients with chronic gastritis infected (+) and not infected (–) with H. pylori

Download (53KB)
5. Figure 5. The content of IL-2 in the blood serum of patients with chronic gastritis infected (+) and not infected (–) with H. pylori

Download (31KB)
6. Figure 6. The content of IL-23 in the blood serum of patients with chronic gastritis infected (+) and not infected (–) with H. pylori

Download (34KB)

Copyright (c) 2022 Mokhonova E.V., Lapin V.A., Melentiev D.A., Novikov D.V., Neumoina N.V., Perfilova K.M., Neumoina M.V., Troshina T.A., Shutova I.V., Novikov V.V.

Creative Commons License
This work is licensed under a Creative Commons Attribution 4.0 International License.

This website uses cookies

You consent to our cookies if you continue to use our website.

About Cookies