Regulation of Clostridiodes difficile CRISPR-Cas system by biofilm-associated factors and glucose

Full Text

Introduction

Clostridioides difficile (syn. Clostridium difficile) [26] is an anaerobic, Gram-positive, spore-forming bacterium, and one is of the major clostridial pathogens. C. difficile causes nosocomial gut infections associated with antibiotic therapy [2]. The disturbance of the microflora by antibiotic therapy leads to the colonization of the intestinal tract by C. difficile cells, resulting in infection. During the infection cycle, this enteropathogen produces main virulence factors (toxins TcdA and TcdB), which cause changes in epithelial cells actin cytoskeleton inside the intestine. This leads to diarrhea and pseudomembranous colitis, a potentially lethal disease [8, 16]. Furthermore, C. difficile produces spores within the host, which subsequently can be released into the environment and contribute to disease spread. During its infection cycle, C. difficile metabolically adapts to changing environments and different stresses [2] and forms biofilms [9]. C. difficile vegetative cells also interact with bacteriophages inside the host gut [25, 37]. Since the last two decades, the number of severe infection forms has been rising due to the emergence of the hypervirulent and antibiotic-resistant strains [4, 12, 30]. Many aspects of C. difficile pathogenesis, including molecular mechanisms of its adaptation to changing conditions inside the host, remain poorly understood.

During their life cycles, prokaryotes must cope with a large number of genetic parasites, including bacteriophages. For this purpose, prokaryotes often use various protective mechanisms. Over the past decade, CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats)-Cas (CRISPR-associated) adaptive immunity systems have become a center of interest among various anti-invader bacterial defense systems [34]. These defensive systems are made up of CRISPR arrays and cas gene operons. CRISPR arrays, in their turn, consist of short, direct repeat sequences (20–40 bp) separated by variable spacers. Spacers are often complementary to phages and other mobile genetic elements [33]. The action of CRISPR-Cas systems can be divided into two main processes: the acquisition of new spacers (CRISPR-adaptation), and CRISPR-interference, when the CRISPR-Cas system compounds are expressed and subsequently form an effector complex consisting of Cas proteins and CRISPR RNAs (crRNAs). This effector complex recognizes the target on the foreign DNA (or RNA, depending on the system type), resulting in degradation of the nucleic acid of the genetic invader [22]. To date, most CRISPR-Cas systems studies were focused on their functionality and the practical usage of these systems in genome editing. However, research on CRISPR-Cas system regulation and its role in bacterial physiology has been progressed significantly in recent years [39]. C. difficile has an original CRISPR-Cas system, which is characterized by an unusually large set of CRISPR arrays (12 arrays in the laboratory 630 strain and 9 in the hypervirulent R20291 strain), two type I-B cas operons, and the link with toxin-antitoxin type I systems [7, 20]. This bacterium should coordinate the functioning of this complex system in response to various signals of changes in the environment and in the physiology of the cell. To date, the regulatory factors of the C. difficile CRISPR-Cas system are still poorly understood.

In the present work we describe the regulation of expression and functioning of the C. difficile CRISPR-Cas system by biofilm-inducing factors and at increased glucose concentration in the nutrient medium.

Materials and methods

Bacterial strains and growth conditions. All bacterial strains used in this study are listed in Table 1. C. difficile strains were grown in brain heart infusion (BHI) (BD Biosciences) medium at 37°C under anaerobic conditions (5% H₂, 5% CO₂, and 90% N₂), within Bactron 300 anaerobic chamber (Sheldon Manufacturing). E. coli strains were grown in LB medium [5], supplemented with ampicillin (Amp) (100 μg/ml) and chloramphenicol (Cm) (15 μg/ml) when it was necessary. The non-antibiotic analog anhydrotetracycline (ATc) was used for induction of the Ptet promoter in C. difficile CD3 strain.

 

Table 1. Strains and plasmids used in this study

Strain	Genotype	Source
E. coli
HB101 (RP4)	supE44 aa14 galK2 lacY1 Δ(gpt-proA) 62 rpsL20 (StrR)xyl-5 mtl-1 recA13 Δ(mcrC-mrr) hsdSB (rB-mB-) RP4 (Tra+ IncP ApR KmR TcR)	Laboratory stock
C. difficile
630Δerm	Sequenced reference strain ΔermB	Laboratory stock, [13]
CD3	630∆erm Ptet-dccA (CD1420)	Laboratory stock
Plasmid	Description	Reference
pRPF185Δgus	Ptet-gusA TmR expression and cloning Clostridium-Escherichia coli shuttle vector, pRPF185 vector derivative	[11, 36]
pDIA6435	pRPF185Δgus with the 5' CCA-PAM protospacer, corresponding to the spacer1 from 630∆erm CRISPR 3 array	[19]
pDIA6436	pRPF185Δgus with the 5' CCA-PAM protospacer, corresponding to the spacer1 from 630∆erm CRISPR 4 array	[19]
pDIA6437	pRPF185Δgus with the 5' CCA-PAM protospacer, corresponding to the spacer1 from 630∆erm CRISPR 6 array	[19]
pDIA6438	pRPF185Δgus with the 5' CCA-PAM protospacer, corresponding to the spacer1 from 630∆erm CRISPR 7 array	[19]
pDIA6439	pRPF185Δgus with the 5' CCA-PAM protospacer, corresponding to the spacer1 from 630∆erm CRISPR 8 array	[19]
pDIA6440	pRPF185Δgus with the 5' CCA-PAM protospacer, corresponding to the spacer1 from 630∆erm CRISPR 9 array	[19]
pDIA6441	pRPF185Δgus with the 5' CCA-PAM protospacer, corresponding to the spacer1 from 630∆erm CRISPR 10 array	[19]
pDIA6442	pRPF185Δgus with the 5' CCA-PAM protospacer, corresponding to the spacer1 from 630∆erm CRISPR 11 array	[19]
pDIA6443	pRPF185Δgus with the 5' CCA-PAM protospacer, corresponding to the spacer1 from 630∆erm CRISPR 12 array	[19]
pDIA6444	pRPF185Δgus with the 5' CCA-PAM protospacer, corresponding to the spacer1 from 630∆erm CRISPR 17 array	[19]

 

RNA extraction and qRT-PCR. To analyze CRISPR-Cas system expression in high cyclic di-guanosine monophosphate (c-di-GMP) level conditions, total RNA was isolated from C. difficile 630Δerm [13] and CD3 strains, grown for 5 and 24 hours in TY medium (tryptone 30 g/L, yeast extract 20 g/L, pH 7.4), supplemented with ATc (250 ng/ml). For the experiments with deoxycholate and glucose, RNA samples were obtained from C. difficile 630Δerm cultures grown for 5 and 24 h in BHI medium (control), BHI medium supplemented with 0.1 M glucose or/and 240 μM sodium deoxycholate. The total RNA isolation, cDNA synthesis and real-time quantitative PCR (qRT-PCR) were performed as previously described in [28] using CFX96™ Real-Time System (Bio-Rad). Primers annealed to the first genes of cas operons, to leader regions and first spacers of CRISPR arrays were used in qRT-PCR (Table 2). In each sample, the relative expression was calculated relative to the 16S rRNA [24]. The relative change in gene expression was recorded as the ratio of normalized target concentrations (ΔΔCt) [18]. The experiments were performed in three biological replications.

 

Table 2. Oligonucleotides used in this study

Name	Sequence (5'→3')	Description
QRTBD37	GGGAGACTTGAGTGCAGGAG	16S RNA qPCR F
QRTBD38	GTGCCTCAGCGTCAGTTACA	16S RNA qPCR R
AM289	GAGAGAATTGTATAGATGTAAGTGTTG	CRISPR 6 qPCR F
OS679	GCAGTGAGCAATATTTGCGATA	CRISPR 3–4/16–15 qPCR F
OS680	CAAATTTGCAGTGAACCATGA	CRISPR 3–4/16–15 qPCR R
AM290	GTGATGAATGTTCAGAAGAGGA	CRISPR 6 qPCR R
AM291	AAGCTTTATCATTTGCACTACTC	CRISPR 7 qPCR F
AM292	CAGTATCTTTTAAGAATTGAGTGGTT	CRISPR 7 qPCR R
AM175	TGCAAATTTAAGAGAGTTGTATACG	CRISPR 8 qPCR F
AM176	TATCTTGAGCTGTCAATGTGAAC	CRISPR 8 qPCR R
AM293	GGATTGAGGGTGTGTGATAAA	CRISPR 9 qPCR F
AM294	CTTGCAAGAATGGTTTTAATAATGAG	CRISPR 9 qPCR R
PB152	GGAGATGCTAAGTTTATTTTGGA	CRISPR 10 F
PB153	TTAAGACTAGCAGACTCATAAGC	CRISPR 10 R
OS472	CCATTGATTTCTTTCAGTTTCG	CRISPR 12 qPCR F
OS473	CGCGTTAGGCAAATACAAGG	CRISPR 12 qPCR R
AM177	TCGCTCACTGCAAATTTTG	CRISPR 17 qPCR F
AM178	AAACGCAGGTCAAACCTTA	CRISPR 17 qPCR R

 

Plasmid conjugation efficiency assays. Plasmid conjugation efficiency assays were performed according to the method described in [19]. To evaluate conjugation efficiency, PAM (protospacer adjacent motif)-protospacer carrying conjugative plasmids were transformed into the E. coli HB101 (RP4) strain and transferred to C. difficile strains by conjugation. BHI plates used at the cultivation stage of conjugative mixtures were supplemented with ATc (250 ng/ml) or 0.1 M glucose or/and 240 μM sodium deoxycholate, depending on the purpose of the experiment. The ratio of C. difficile transconjugants was counted by subculturing conjugation mixtures on BHI agar supplemented with thiamphenicol (Tm) (15 μg/ml), D-cycloserine (Cs) (25 μg/ml) and cefoxitin (Cfx) (8 μg/ml) and comparing with the number of colony-forming units obtained after plating serial dilutions on BHI agar plates containing Cfx only. The experiments were performed in two technical and two biological replications. All the plasmids used in this work are listed in Table 1.

Results

C. difficile CRISPR-Cas system expression under high cyclic di-guanosine monophosphate intracellular levels. Cyclic di-guanosine monophosphate (c-di-GMP) is a bacterial secondary messenger controlling diverse processes in bacterial cells, and it is mostly known to be an important signal molecule for the transition from the planktonic phenotype to the biofilm state [6]. In this work, we performed experiments to investigate C. difficile CRISPR-Cas system regulation under high c-di-GMP intracellular levels. For this proposal, C. difficile CD3 strain, carrying a chromosomal diguanylate cyclase gene (dccA) [29] under the control of an inducible tetracycline promoter (Ptet) was used. The induction of this gene causes an artificial increase of intracellular levels of c-di-GMP in C. difficile.

The qRT-PCR analysis revealed expression levels changes of CRISPR arrays and cas operons in the CD3 strain after 5 h and 24 h of cultivation with the ATc inducer (Fig. 1A). The expression of both cas operons and all CRISPR arrays decreased after 5 h of growth. An increase in the expression levels of the partial cas operon and all CRISPR arrays was observed after 24 h of cultivation (Fig. 1A) with the effect being most pronounced for CRISPR arrays 8 and 17.

 

Figure 1. C. difficile CRISPR-Cas system regulation under high intracellular levels of cyclic di-guanosine monophosphate (c-di-GMP)

Note. A. qRT-PCR analysis of the C. difficile CRISPR-Cas system expression in high c-di-GMP levels conditions after 5 and 24 hours of cultivation. B. Plasmid conjugation efficiencies in C. difficile 630Δerm (CD630) and CD3 strains. CRISPR 3–4…17 — indicate CRISPR-arrays. CRISPR 3 and CRISPR 4 arrays are cotranscribed and presented as CRISPR 3–4. Sequences of CRISPR 3–4 and CRISPR 16–15 arrays of are identical [7]; therefore, CRISPR 16–15 are not presented. In conjugation experiments, plasmids carrying different protospacers corresponding to each C. difficile 630Δerm first spacers (sp1) in different CRISPR arrays and flanked by CCA PAM were used. An empty vector was used as a conjugation control. Lack of transconjugants indicate conjugation efficiencies of less than or equal to 10^–9.

 

Role of high c-di-GMP intracellular levels on C. difficile CRISPR-Cas system interference functionality. To investigate the role of c-di-GMP on C. difficile CRISPR-Cas system functionality, we performed plasmid interference assays with CD3 and 630Δerm strains. In these experiments, a set of plasmids containing protospacers corresponding to a selected spacer of C. difficile 630Δerm CRISPR array, flanked by functional CCA PAM on the 5'-end were used [19]. An empty pRPF185Δgus vector served as a conjugation control [11, 36]. The presence of a protospacer with a correct PAM sequence matching a spacer from one of the CRISPR arrays inhibits conjugation efficiency by several orders of magnitude. Hence, higher conjugation efficiencies correspond to lower CRISPR interference levels. These experiments showed slight induction of CRISPR interference under high c-di-GMP intracellular levels (Fig. 1B). Increased levels of interference were observed in the CRISPR 9, 10, 12, and 17 arrays. The most significant changes in conjugation efficiency were detected in CRISPR 17 array. At the same time, the results of expression analysis showed a significant induction of expression only in CRISPR 17 array. In the cases of CRISPR 9, 10, and 12 arrays, the increase in expression levels was less intense (Fig. 1A).

Analysis of C. difficile CRISPR-Cas system transcription levels in the presence of sodium deoxycholate in medium. During its infection cycle, C. difficile faces different adverse factors inside the host. Among, these factors there are secondary bile salts deoxycholates. A recent study showed that low concentrations of deoxycholates induce biofilm formation in C. difficile [10]. Therefore, deoxycholates can be considered as biofilm-inducing factors, and they could participate in this pathogen CRISPR-Cas system regulation.

To analyze the expression levels of the CRISPR-Cas system, the qRT-PCR was performed with total RNA isolated from C. difficile 630Δerm cells grown in BHI medium supplemented with 0.1 M glucose (control) or with 0.1 M glucose and 240 μM sodium deoxycholate. The glucose addition to the nutrient medium was necessary since deoxycholate-induced biofilm forming occurs only in the presence of this sugar [10]. However, qRT-PCR analysis revealed changes in CRISPR arrays transcription levels in control samples (with glucose only) compared to the values obtained previously for C. difficile 630Δerm cells grown in BHI medium without glucose [19]. Subsequently, glucose may also contribute to C. difficile CRISPR-Cas system regulation. Therefore, further experiments were held with C. difficile 630Δerm cells grown in medium supplemented with sodium deoxycholate only. Expression analysis showed a significant increase in both cas operons and CRISPR 17 array after 5 h of cultivation with deoxycholate (Fig. 2). On the contrary, expression levels of all CRISPR-Cas system components were decreased after 24 h of growth (Fig. 2). Notably, the growth of C. difficile cultures in the presence of deoxycholate was vastly inhibited due to the toxicity of this bile salt. Consequently, it was challenging to assess conjugation efficiency under these conditions.

 

Figure 2. C. difficile CRISPR-Cas system expression in the presence of sodium deoxycholate in medium after 5 and 24 hours of growth

Note. CRISPR 3–4…17 — indicate CRISPR-arrays. CRISPR 3 and CRISPR 4 arrays are cotranscribed and presented as CRISPR 3–4. Sequences of CRISPR 3–4 and CRISPR 16–15 arrays of are identical [7]; therefore, CRISPR 16–15 are not presented.

 

Role of glucose in C. difficile CRISPR-Cas system expression. As was revealed above, increased concentrations of glucose in the nutrient medium may be involved in the regulation of C. difficile CRISPR-Cas system. To investigate the potential effect of glucose on C. difficile CRISPR-Cas system expression, qRT-PCR experiments were performed. These assays demonstrated a significant induction of partial cas operon and CRISPR 3–4 array expression levels after 5 h of growth in the presence of glucose (Fig. 3A). After 24 h of cultivation, the expression of all CRISPR-Cas components was decreased (Fig. 3A).

 

Figure 3. C. difficile CRISPR-Cas system regulation at high glucose concentration in the medium

Note. A. qRT-PCR analysis of the C. difficile CRISPR-Cas system expression in the presence of glucose after 5 and 24 hours of cultivation. B. Plasmid conjugation efficiencies in C. difficile 630Δerm under normal growth conditions (BHI) and when 0.1M glucose was added to the growth medium (BHI+glucose). CRISPR 3–4…17 — indicate CRISPR-arrays. CRISPR 3 and CRISPR 4 arrays are cotranscribed and presented as CRISPR 3–4. Sequences of CRISPR 3–4 and CRISPR 16–15 arrays of are identical [7]; therefore, CRISPR 16–15 are not presented. In conjugation experiments, plasmids carrying different protospacers corresponding to each C. difficile 630Δerm first spacers (sp1) in different CRISPR arrays and flanked by CCA PAM were used. An empty vector was used as a conjugation control. Lack of transconjugants indicate conjugation efficiencies of less than or equal to 10^–9.

 

CRISPR interference assays in increased glucose levels conditions. Next, we evaluated interference efficiency at increased glucose concentration in the medium. We observed a reduction of CRISPR 9, 12, and 17 arrays interference levels compared to the control (Fig. 3B). This may indicate that the presence of glucose in the medium negatively regulates C. difficile CRISPR-Cas system defensive function. At the same time, the expression induction of some CRISPR-Cas components was observed under these cultivation conditions (Fig. 3A).

Discussion

Human enteropathogenic bacterium C. difficile possesses a complex defensive CRISPR-Cas system, composed of many components. This system could be involved in this bacterium infection cycle and its adaptation to changing environments inside the host. Therefore, C. difficile CRISPR-Cas system should regulate its activity in response to various physiological and environmental signals. In this work, we performed a study of C. difficile CRISPR-Cas system regulation under biofilm-inducing factors. Biofilm mode of bacterial growth is characterized by a high density of the cells and the high possibility of horizontal gene transfer by different mobile genetic elements, including phages [1, 17]. Consequently, the positive regulation of the CRISPR-Cas system expression could be an adaptive strategy of C. difficile to increase chances of genetic parasites acquisition.

The secondary messenger c-di-GMP is one of the key components in the regulation of such phenotypic shifts in bacteria [31]. Using quantitative PCR, we analyzed expression of all C. difficile 630Δerm CRISPR-Cas system components and revealed the induction of several CRISPR arrays and the partial cas operon in the presence of high c-di-GMP levels. These results were partially confirmed on the functional level by interference efficiency assays. To date, the research of c-di-GMP role in CRISPR-Cas systems regulation is only at the very beginning of its way. A recent work demonstrated that this secondary messenger negatively regulates the expression of Erwinia amylovora type I-E cas genes [15]. Thus the present study is, to our knowledge, the first to demonstrate positive regulation of CRISPR-Cas system components and functionality by c-di-GMP. Mechanistically, c-di-GMP works through binding effector proteins or riboswitches to modulate downstream gene regulatory networks [31, 35]. Therefore, in relation to CRISPR-Cas systems, c-di-GMP role appears to be indirect through affecting global regulatory proteins or RNA metabolism rather than direct gene transcription regulation. These mechanisms remain to be elucidated in further research.

Another biofilm formation factor explored in this work is the secondary bile salt deoxycholate [10]. In the presence of sodium deoxycholate in the medium, we detected an increase in expression levels of both cas operons and one CRISPR array. Therefore, these secondary bile salts can be a regulation factor for C. difficile CRISPR-Cas system. The link between the of presence sodium deoxycholate in medium and CRISPR-Cas system alternative function was observed in Salmonella Typhi [23]. This work showed the contribution of the CRISPR-Cas system to sodium deoxycholate resistance through the regulation of porin expression. Moreover, the enhanced biofilm formation observed in the cas mutants suggests that this system negatively regulates biofilm-associated genes. The complex C. difficile CRISPR-Cas system also may have non-canonical functions in this bacterium physiology [21] and induction of several CRISPR-Cas components by sodium deoxycholate might indicate their potential role in C. difficile survival within the host.

In addition, in experiments with deoxycholate and glucose in the medium, a regulatory effect of glucose was found. We observed an increase in expression levels of the partial cas operon and one CRISPR array under high glucose concentration in the nutrient medium. At the same time, the presence of glucose decreased interference levels. This may indicate that increased glucose concentrations in the medium negatively regulate the functioning of the C. difficile CRISPR-Cas system despite the expression induction of its components. The regulation effect of glucose was also demonstrated for the CRISPR-Cas systems in Thermus thermophiles, Pectobacterium atrosepticum and E. coli [27, 32, 38]. High levels of cyclic adenosine monophosphate (cAMP) which is associated with glucose starvation have been shown to positively and negatively regulate the expression and activity of these systems. In C. difficile catabolite control protein A (CcpA) is a major global transcriptional regulator, and it is involved in response to changes in glucose levels [3]. A recent study revealed that one cas operon is directly regulated by CcpA in Streptococcus mutans [14]. Global regulators such as CcpA may also participate in the control of CRISPR-Cas activity in C. difficile. Further studies are needed to clarify the scope and mechanisms of this possible regulatory involvement.

Conclusion

Altogether obtained results demonstrate the regulation of the C. difficile CRISPR-Cas system under biofilm conditions and in the presence of glucose in the nutrient medium. Our data indicate that C. difficile CRISPR-Cas system is subject for complex regulation by environmental and metabolic signals, suggesting its potential role beyond canonical defense functions, especially in the adaptation of this pathogen to the changing conditions inside the host. A more detailed analysis of C. difficile CRISPR-Cas system regulation is required, particularly with respect to other biofilm-related stimuli and stresses, as well as the molecular mechanisms underlying these regulatory processes.

Additional information

Declaration of competing interest. The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

Acknowledgments. We are grateful to O. Soutourina and J. Peltier for providing C. difficile strains and helpful discussions during the work.

About the authors

Anna S. Maikova

St. Petersburg Pasteur Institute; Peter the Great St. Petersburg Polytechnic University

Author for correspondence.
Email: ann-maikova@yandex.ru

PhD (Biology), Researcher, Laboratory for Molecular Genetics of Pathogens, Researcher, Research Complex “Nanobiotechnologies”

Russian Federation, St. Petersburg; St. Petersburg

D. E. Polev

St. Petersburg Pasteur Institute

Email: ann-maikova@yandex.ru

PhD (Biology), Senior Researcher, Head of the Metagenomic Research Group

Russian Federation, St. Petersburg

M. A. Khodorkovskii

Peter the Great St. Petersburg Polytechnic University

Email: ann-maikova@yandex.ru

PhD (Physics and Mathematics), Head of the Research Complex “Nanobiotechnologies”

Russian Federation, St. Petersburg

References

Supplementary files