Gene polymorphism of mannose-binding lectin-associated serine protease (MASP2) in indigenous populations of the Russian Arctic Territories

Cover Page

Cite item

Abstract

Mannose-binding lectin-associated serine proteases (MASP) are among of the key components in the lectin pathway (LP) of the complement activation. MASP-2 is the most studied agent among specific enzymes activating both mannose-binding lectin (MBL) and ficolins, pattern-recognition proteins involved in the elimination of pathogenic microorganisms through LP complement activation. There are some mutations in MASP2, with the most significant identified as rs72550870 (p.D120G). The homozygous GG rs72550870 is associated with congenital MASP-2 deficiency and characterized by a total lack of serum protease activity, which leads to impaired binding to lectins. This, in turn, results in severe course of infectious diseases with a high risk of adverse outcome. There seem to be some marked populational differences in the genotype and haplotype prevalence in MASP2 gene polymorphisms. To date, no data are available on the genotype distribution for the MASP2 gene in the indigenous populations of the Russian Arctic regions. The aim of the work was to study the prevalence and ethnic specificity in the distribution of allelic variants of MASP2 rs72550870 in the populations of the Taymyr Dolgan-Nenets District of the Krasnoyarsk Territory (Nenets, Dolgans, Nganasans) as well as the city of Krasnoyarsk (Russians). MASP2 genotyping was performed by using real-time PCR. The frequencies of the AG genotype associated with low MASP-2 level was 6.6% for ethnic Russian newborns in the Eastern Siberia. The prevalence of the AG genotype was significantly lower in newborns of the Arctic populations than in the Russians, being 0.3% and 0.9% for the Nenets and the Dolgan-Nganasans, respectively, which is close to the prevalence values identified for Asian and African populations (0%). No homozygous GG rs72550870 associated with congenital MASP-2 deficiency in newborns of the indigenous populations of the Taymyr Dolgan-Nenets region of Krasnoyarsk Territory (Nenets and Dolgan-Nganasans) and ethnic Caucasian subjects of the Krasnoyarsk city was detected. The frequency of the rare allelic variant G rs72550870 in ethnic Russian subjects was 3.3%, being close to the frequencies in the European populations of the world (4.0%), whereas it was 0.5% in the indigenous inhabitants of the Arctic Region. We have suggested that isolated Arctic populations encounter some intracellular infections historically later and, as contrasted with Caucasoid populations, retained a high activity in the lectin pathway of the complement activation established at the early stage of human evolution.

Full Text

Введение

Врожденные дефекты системы комплемента в патогенезе различных заболеваний от инфекционных до аутоиммунных и кардиометаболических составляют не менее 5% общего числа первичных иммунодефицитов, а многие аспекты их распространенности и патогенеза остаются неизученными [7]. Система комплемента является древнейшим компонентом врожденного иммунитета, основной функцией которого является ликвидация инфекционных агентов и собственных клеток организма человека. Кроме того, протеины комплемента создают связь между системами врожденного и адаптивного иммунитета, обеспечивая нормальные условия для созревания и дифференциации В- и Т-лимфоцитов. Плазменные протеины взаимодействуют между собой тремя известными путями: лектиновым (наиболее филогенетически древним), альтернативным и классическим.

Лектины — общий термин протеинов, формирующих отдельное суперсемейство рецепторов [3], способных к распознаванию и агрегации молекул олиго- и полисахаридной природы. Среди всех лектинов уникальными функциями формирования комплексов с углеводными компонентами микробной стенки обладают фиколины и коллектины — маннозосвязывающий лектин (mannose-binding lectin, MBL), печеночный и почечный коллектины [26]. Образование сложного комплекса: полисахариды микробной стенки + коллектин/фиколин + специфические протеазы (Mannose-binding lectin-Associated Serine Protease: MASP-1, MASP-2 и MASP-3) приводит к активации лектинового пути системы комплемента, воспалительной реакции и элиминации бактерии. Дефицит или дефект какого-либо из звеньев такого комплекса приводит к нарушению защитных функций иммунитета, повышается подверженность заболеваниям.

На иммунологическую функцию лектинов влияют мутации в промоторном регионе и в кодирующей части их генов, модулируя транскрипционную активность и изменяя концентрацию белка. Так, доминантные мутации в 1 экзоне гена MBL, расположенного на 10 хромосоме (10q11.2-q21), приводят к снижению способности MBL к олигомеризации и, соответственно, к снижению его концентрации в плазме и функциональной активности. Для оценки клинических последствий генетически детерминированных различий в экспрессии MBL было предложено выделять MBL-дефицитные, MBL-промежуточные и высоко экспрессирующие MBL диплотипы [12]. В целом считается, что 20–25% всей человеческой популяции являются носителями MBL-дефицитных гаплотипов, а у 8–10% MBL в плазме крови отсутствует или крайне низок [9]. Большинство MBL-дефицитных индивидов являются в целом здоровыми. В то же время значительное количество исследований показывает, что генетически детерминированный уровень MBL может модифицировать риск возникновения и клинические характеристики многих инфекционных заболеваний, а недостаточность MBL считается наиболее частым иммунодефицитом человека, имеющим множество клинических ассоциаций [25]. Причем, такое влияние имеет разнонаправленный характер. Многочисленные исследования связывают дефицит MBL с повышенной восприимчивостью к ряду инфекционных и аутоиммунных заболеваний [5, 6]. Высокий уровень MBL является защитным фактором в отношении возникновения и тяжести инфекций, вызванных инкапсулированными бактериями, прежде всего у детей раннего возраста [2]. Тем не менее была высказана гипотеза, что нормальные/высокие уровни MBL могут повышать риск инфицирования и воспалительной реакции при инфекциях, вызванных некоторыми внутриклеточными возбудителями (Mycobactеrium tuberculosis, Mycoplasma pneumoniae, Chlamydophila pneumoniae и др.) [10]. Следовательно, носители некоторых MBL-дефицитных гаплотипов могут иметь определенное клиническое преимущество при этих внутриклеточных инфекциях.

Фиколины — лектин-распознающие молекулы, структурно и функционально гомологичные MBL. Описано три вида фиколинов: M-фиколин, кодирующийся геном FCN1, L-фиколин (FCN2) и H-фиколин (FCN3). Структура фиколинов очень похожа на структуру МBL и также имеет домен, авидный к тем же углеводным компонентам бактерий, что и MBL. Описаны полиморфизмы промоторных и структурных регионов генов фиколинов, ответственные за многократные различия в концентрации белка, а полное отсутствие фиколинов (нулевые плазменные уровни), в отличие от MBL, к настоящему времени не зафиксировано. Опубликованные результаты исследований связи концентрации и полиморфизмов генов фиколинов с какими-либо заболеваниями немногочисленны. Польские исследователи показали, что у детей с атопией с частыми респираторными инфекциями выявляются более низкие концентрации L-фиколина в плазме крови [8]. А. Mishra и соавт. [18] показали, что высокие плазменные уровни L-фиколина обусловлены его низкой функциональной способностью связывать бактерию и, соответственно, меньшей способностью накапливаться в очаге воспаления. Наиболее изучен ген FCN2, расположенный в хромосомной области 9q34.3. Была обнаружена связь между полиморфизмом FCN2, повышенными уровнями L-фиколина в плазме и восприимчивостью к висцеральному лейшманиозу, шистосомозу, гепатиту B и туберкулезу [18].

Помимо MBL и фиколинов, одним из ключевых участников лектинового пути активации комплемента является семейство маннозосвязывающих лектин-ассоциированных сериновых протеаз (MASP). В семействе MASP были идентифицированы три протеазы (MASP-1, MASP-2, MASP-3) и два родственных неферментативных белка, MAp19 (sMAP) и MAp44 (MAP1). Наиболее изученной среди специфических ферментов, способных активировать как MBL, так и фиколины, является протеза 2 типа — MASP-2. В результате анализа уровня MASP-2 в плазме у людей из различных этнических групп показано, что самым низким уровень был у африканцев, за которыми следовали китайцы из Гонконга, индейцы и датчане европеоидной расы [25]. Полиморфный ген MASP2 расположен на хромосоме 1p36.23-31, имеет 12 экзонов и кодирует два белка, MASP-2 и MAp19. Наиболее значимой мутацией MASP2 является rs72550870 (p.D120G), она приводит к замене аспарагиновой кислоты на глицин, вследствие чего белок теряет способность активировать комплемент из-за невозможности образовывать комплексы с лектинами, в частности с MBL. Врожденный дефицит MASP-2 обусловлен мутацией rs72550870 в гомозиготном состоянии (GG), характеризуется полным отсутствием сывороточной активности протеазы и приводит к нарушению связывания с MBL и с фиколинами [22, 24]. Всего тринадцать случаев гомозиготного носительства GG rs72550870 было описано в литературе с момента выявления первого случая, зарегистрированного в 2003 г. [22].

Клинические проявления снижения/отсутствия активности MASP-2 могут варьировать от полного здоровья до тяжелых инфекций и предрасположенности к онкологическим заболеваниям [5]. После того как появились данные о трех здоровых взрослых с дефицитом MASP-2, гомозиготных по GG в MASP2 [11, 20], клиническая пенетрантность этого дефицита стала сомнительной. Вероятно, что в LP участвуют неидентифицированные молекулы и функции, которые могут объяснить, почему дефицит MASP-2 относительно часто встречается у практически здоровых людей [5]. Было высказано предположение, что лектиновый путь активации системы комплемента необязателен или даже избыточен (например, при тяжелом течении COVID) для формирования иммунного ответа у большинства здоровых лиц, а его дефицит клинически значим только в определенных ситуациях, например у недоношенных новорожденных.

Таким образом, ассоциация дефицита MASP-2 (GG rs72550870) с клиническими проявлениями в настоящее время является неопределенной.

Этнические особенности частот распределения полиморфизмов генов компонентов лектинового пути активации комплемента. Распределение частот гаплотипов гена MBL имеет крайне выраженные популяционные различия. Так, частота встречаемости гаплотипа HYPA, ассоциированного с высокой концентрацией MBL, варьирует от 6–8% в африканских популяциях (Мозамбик, Кения), до 64–81% в северных коренных популяциях (североамериканские индейцы, инуиты). Европеоиды занимают промежуточное положение с 27–30% частотой гаплотипа HYPA [4, 13, 16].

Минорный аллель FCN2 rs17549193 (+6359C>T) связан со значительным снижением связывающей способности L-фиколина с углеводными компонентами клеточных стенок бактерий, в то время как минорный аллель rs7851696 (+6424G>T) связан с повышенной связывающей способностью [14]. Кроме того, было показано, что у здоровых голландских доноров уровни L-фиколина в плазме прогрессивно снижались в зависимости от наличия мутантного аллеля rs7851696. Это свидетельствует о том, что данный вариантный аллель связан с высокой тканевой активностью L-фиколина и одновременно с его низкой концентрацией в плазме. Не было обнаружено статистически значимой связи между концентрацией L-фиколина в сыворотке и полиморфизмом rs17549193 в этой голландской когорте [19]. В то же время некоторые исследования показали, что высокие уровни L-фиколина были связаны с вариантным аллелем rs17549193 [8].

Данные о популяционных частотах полиморфизмов гена MASP2 стали появляться в литературе относительно недавно. Так, в датской когорте частота редкого аллеля G* rs72550870 составила 3,9%, такая же частота выявлена в исландской выборке взрослых доноров. Интересно, что аллель G вообще не был выявлен в популяциях китайцев Гонконга, африканских замбийцев и коренных американцев Бразилии [25].

Данные о частотах распределения полиморфизмов генов MBL2, FCN2, FCN3 и MASP2 в российских популяциях и патогенетической роли компонентов лектинового пути компонента крайне немногочисленны. А.О. Романов и соавт. [1] изучили распространенность одного полиморфизма +230G/A гена MBL у жителей Санкт-Петербурга: гомозиготы по мутантному аллелю A составили 30 (25%) и 5 (4%) соответственно. Авторы делают вывод что, «учитывая частую встречаемость мутации гена MBL, являющейся причиной первичного иммунодефицита, в популяции Санкт-Петербурга, необходим скрининг пациентов с рецидивирующими инфекциями». Ряд исследований российских авторов был посвящен клинико-генетическим сопоставлениям мутаций в гене MBL с риском сердечно-сосудистых заболеваний, преэклампсии, особенностями клинической картины муковисцидоза и прогрессирования ВИЧ-инфекции.

Результаты наших более ранних исследований [23] показывают, что частота высоко-продуцирующего гаплотипа HYPA гена MBL2 составляет 35,4% у русских новорожденных Восточной Сибири, что соответствует частотам в Европейских популяциях (голландцы — 27%, датчане — 30%, чехи — 33%), а также у европеоидов Бразилии (28–34%). В то же время у новорожденных Таймырского Долгано-Ненецкого района Красноярского края частота гаплотипа HYPA была статистически значимо выше, чем у русских, и составила 64% для ненцев и 56% для долган-нганасан, что близко к значениям частот распространения выявленных для эскимосов (81%) и североамериканских индейцев (64%). Кроме того, в аборигенных популяциях как ненцев, так и долган-нганасан по сравнению с русским населением мы обнаружили снижение распространенности генотипа полиморфизма FCN2 rs7851696, связанного с низким сродством L-фиколина к углеводам. Результаты нашего исследования [21] показали, что ненецкая популяция обладает рядом важных особенностей по сравнению с долганами-нганасанами: более низкой распространенностью аллеля T для полиморфизма rs17549193 и более высокой распространенностью аллеля T для полиморфизма rs7851696 FCN2. Мы полагаем, что этот генотип является генетическим маркером высокой функциональной способности L-фиколина в ненецкой популяции.

Согласно анализу доступных нам литературных данных, в настоящее время популяционные частоты мутаций, ассоциированных с врожденным дефицитом MASP-2 (rs72550870), в российских популяциях и в популяциях коренных народностей российских арктических территорий не изучены. Актуальность получения таких данных для российских арктических популяций значительно возрастает, учитывая накапливающиеся доказательства важной роли лектинового пути активации комплемента в отношении вирусных инфекций. Так, например, предполагается важная роль MBL в отношении респираторных вирусных инфекций, в том числе инфекции, вызываемой новым коронавирусом SARS-CoV-2 — COVID-19 [15, 17]. Роль врожденных дефицитов протеинов LP, в том числе MASP-2, в таких клинических ситуациях совершенно не изучена. Принимая во внимание то, что инфекции являются основными факторами детской смертности, а лектины являются решающими факторами противоинфекционной защиты, вероятно, что дефицит лектинов будет способствовать увеличению смертности.

Целью данной работы было выявить популяционно-этнические различия распределения аллельных вариантов гена маннозосвязывающей лектин-ассоциированной сериновой протеазы (MASP2) у коренных популяций Таймырского Долгано-Ненецкого района Красноярского края (ненцев и долган-нганасан) по сравнению с европеоидами города Красноярска.

Материалы и методы

Для изучения однонуклеотидного полиморфизма MASP2 rs72550870 использованы 920 образцов высохших пятен крови от новорожденных из Таймырского Долгано-Ненецкого района Красноярского края и города Красноярска, полученные ранее в Красноярском краевом консультативно-диагностическом центре медицинской генетики.

Демографические характеристики обследованных новорожденных по региону проживания матери опубликованы в нашем раннем исследовании [21]. Новорожденные были разделены на четыре группы для изучения этнической специфики полиморфизма MASP2: 1) 323 из деревень с преимущественно ненецким населением (ненцы составляют 85% населения); 2) 112 из деревень с преимущественно долган-нганасанским населением (долган-нганасаны составляют 91% населения); 3) 243 из деревень со смешанным населением с различной комбинацией коренных и смешанных популяций; 4) 242 новорожденных из города Красноярска, у которых были европейские корни (русские).

Исследование было одобрено Этическим комитетом Научно-исследовательского института медицинских проблем Севера (№ 9 от 08.09.2014). Получено письменное информированное согласие на проведение исследования от всех участников.

Материалом исследования послужила ДНК, выделенная из сухих пятен крови с использованием набора DIAtom DNAPrep100 (ООО «Изоген», Россия). Генотипирование rs72550870 было осуществлено при помощи метода ПЦР в режиме реального времени с использованием специфических олигонуклеотидных праймеров и флуоресцентно меченных зондов (TagMan) (ООО «ДНК-синтез», Россия) по протоколу производителя. Нуклеотидная последовательность аллель-специфической пробы для генотипирования: rs72550870-F = GCAAGGACACTTTCTACTCGC, rs72550870-R = TCACCCTCGGCTGCATAG, флюорофор FAM соответствовал аллельному варианту A, а VIC — аллельному варианту G.

Соответствие частот генотипов равновесию Харди–Вайнберга было проверено с использованием χ2. Статистически значимые различия были приняты при р < 0,05 после коррекции для множественного тестирования.

Результаты и обсуждение

Преимуществом нашего подхода к популяционной оценке распространенности иммунодефицитных генотипов является исследование новорожденных, когда еще не произошло исключение неблагоприятных генетических вариаций, возможное в старшем возрасте в результате клинической реализации генетической предрасположенности.

Частоты генотипов и вариантного аллеля MASP2 rs72550870 представлены в таблице. Анализ распространенности генотипов MASP2 показал преобладание гомозиготного варианта AA во всех исследованных в работе популяциях, что совпадает с доступными мировыми данными. Гетерозиготный генотип AG rs72550570 встречается в единичных случаях у ненцев и долган-нганасан по сравнению с новорожденными европеоидного происхождения из г. Красноярска. Частота генотипа AG у русских (6,6%) статистически значимо выше, чем у арктических популяций (ненцы: 0,3%, p < 0,001; долганы-нганасаны: 0,9%, p = 0,02; смешанные: 2,1%, p = 0,02). Таким образом, гетерозиготный вариант AG присутствует у 16 из 242 русских новорожденных, тогда как из 23 ненцев только у одного. Ни в одной из популяционных групп не было обнаружено гомозигот по минорному аллелю G*, ассоциированному с отсутствием сывороточной активности протеазы.

 

Таблица. Частоты генотипов MASP2 у новорожденных различных этнических популяций Таймырского Долгано-Ненецкого района Красноярского края и города Красноярска, n (%)

Table. MASP2 genotype frequencies among newborns from different ethnic populations of the Taymyr Dolgan-Nenets Region in the Krasnoyarsk Krai and the city of Krasnoyarsk, n (%)

Генотип MASP2

Genotype MASP2

(rs72550870)

Ненцы

Nenets

(n = 323)

Долганы-нганасане

Dolgans-Nganasans

(n = 112)

Смешанная популяция

Mixed Arctic populations

(n = 243)

Русские

Russians

(n = 242)

р

AA

322 (99,7)

111 (99,1)

238 (97,9)

226 (93,4)

1–3 = 0,05

1–4 < 0,001

2–4 = 0,02

3–4 = 0,01

AG

1 (0,3)

1 (0,9)

5 (2,1)

16 (6,6)

1–3 = 0,05

1–4 < 0,001

2–4 = 0,02

3–4 = 0,01

GG

0 (0)

0 (0)

0 (0)

0 (0)

G*

1 (0,2)

1 (0,4)

5 (1,0)

16 (3,3)

1–3 = 0,05

1–4 < 0,001

2–4 = 0,02

3–4 = 0,01

Примечание. Указаны только значения р ≤ 0,05.

Note. Values with significant р ≤ 0.05 are shown only.

 

Аллельный вариант G* MASP2 rs72550870 имеет нулевые или крайне низкие частоты в популяциях мира. Согласно источнику ensemble.org, частота в европеоидных популяциях составляет 4,0%, в американской популяции — 2,0%, а среди азиатских и африканских популяций она нулевая.

В результате нашего исследования получены данные о распространенности мутантного аллеля G* rs72550870 в Российских арктических популяциях: 0,5% среди новорожденных Таймырского Долгано-Ненецкого района Красноярского края (n = 678) и 3,3% среди русских города Красноярска (n = 242).

В двух наиболее информативных исследованиях, проведенных группой S. Triel в 2007 и 2009 гг., получены данные о девяти мутациях в гене MASP2, частота встречаемости мутантных аллельных вариантов почти во всех крайне низкая. Только в результате мутации rs72550870 происходят изменения структуры белка MASP-2, что ведет к нарушению его связывания в комплекс с MBL и, как результат, неспособности активировать систему комплемента. Кроме этого, авторы отмечают, что именно у европеоидов вариантный аллель G rs72550870 является основной причиной более низких уровней MASP-2 [25]. По результату популяционного анализа сообщается об отсутствии гомозиготного генотипа GG rs72550870 среди взрослых китайцев, африканцев, европеоидов, инуитов Гренландии и бразильцев [25]. Гетерозиготный вариант преобладал у европеоидов из Дании (3,9%) и инуитов Западной Гренландии (где высока примесь европеоидной популяции, как сообщают авторы) (3,7%), но не встречался в других исследованных популяциях (р < 0,0001). Также авторы приводят частоты редкого аллельного варианта, полученные другими исследователями в разных популяциях у здоровых лиц и пациентов с различными заболеваниями. Так, в шведской популяции обнаружено 14 гетерозигот у 112 пациентов с муковисцидозом (частота 6,3%) и пять гетерозигот у 200 здоровых людей (частота 1,3%). В исследовании пациентов с псориазом и членов их семей 894 человека были протестированы на MASP2 rs72550870, и в общей сложности было обнаружено 62 гетерозиготы и одна гомозигота, что дало частоту гена 3,6% (аллель не был связан с псориазом). Гомозиготность была зарегистрирована у одного человека в группе из 293 польских детей с респираторными инфекциями и у одного ребенка с муковисцидозом. Новое исследование испанской популяции выявило двух гомозиготных из 2008 человек (включая 967 пациентов с пневмонией, 130 пациентов с СКВ, 43 ребенка с рецидивирующими респираторными инфекциями и 868 здоровых людей), но ассоциации заболеваний с вариантным аллелем не было выявлено. Отсутствие аллеля G MASP2 rs72550870 в Китае подтверждается отчетом, в котором исследуется влияние генотипов MBL2 и MASP2 на предрасположенность к тяжелому острому респираторному синдрому (SARS). У всех 1757 протестированных азиатов аллель G обнаружен не был. Таким образом, следует сделать вывод, что в случае MBL, а также других компонентов комплемента (в том числе MASP2), дефицит сам по себе не приводит к заболеванию или восприимчивости к инфекциям, а, скорее, является модификатором, который может проявляться клинически, когда также нарушаются другие элементы.

Кроме этого, распределение частот мутаций, ассоциированных с концентрацией протеазы MASP-2, в разных популяциях отличается. Отмеченное выше географическое распространение rs72550870 MASP2 в соответствии с данными ресурса ensemble.org и данными исследований ряда авторов может отражать результат эволюционной адаптации к разным условиям проживания либо, как мы полагаем, результат «эффекта основателя». Иными словами, указанная мутация может быть исторически молодой и частота ее распределения между континентами и изолированными народностями связана с популяционно-генетическими процессами, не включающими естественный отбор.

Как указывалось выше, в настоящее время популяционные частоты мутаций, ассоциированных с врожденным дефицитом MASP-2 (rs72550870) в российских популяциях в целом и в популяциях коренных народностей российских арктических территорий в частности, не изучены. В нашем исследовании были впервые получены данные о частотах генотипов rs72550870 MASP2 среди коренных народностей российских арктических территорий. При этом ранее нами было показано, что популяции коренных народов Арктики генетически характеризуются большей активностью как минимум двух различающихся компонентов лектинового пути активации комплемента — MBL и L-фиколина [21, 23].

В основе гипотезы, объясняющей результаты настоящего и предыдущих наших исследований [21, 23], лежит предположение о том, что эволюция человека продвигалась в направлении накопления генотипов с низкой активностью лектинового пути активации комплемента вследствие широкого распространения некоторых внутриклеточных инфекций, таких как туберкулез и лепра, при которых низкая активность отдельных компонентов каскадного пути может оказывать защитный эффект. Мы предполагаем, что изолированные арктические популяции Таймырского Долгано-Ненецкого района Красноярского края исторически позже столкнулись с этими инфекциями и, таким образом, сохранили сформированную на ранних этапах эволюции человека высокую активность лектинового пути активации комплемента. В соответствии с указанной гипотезой мы выявили более низкие показатели распространенности генетических маркеров MASP-2 дефицитов в популяциях коренных жителей арктических территорий Красноярского края по сравнению с европеоидами г. Красноярска.

Исследование этнически-ассоциированного уровня неспецифической противоинфекционной защиты среди коренного населения Таймырского Долгано-Ненецкого района Красноярского края можно будет использовать для формирования планов органов практического здравоохранения в отношении профилактики инфекционной заболеваемости и в целях наиболее рационального привлечения трудовых ресурсов для работ в условиях возможной высокой инфекционной нагрузки. Дополнительный анализ инфекционной заболеваемости в арктических популяциях, которые мы планируем изучать далее, позволит выявить фенотипические характеристики, сопряженные с высокой функциональной активностью лектинового пути активации комплемента в роли важнейшего фактора первой линии противоинфекционной защиты, в том числе и в отношении новых вирусных заболеваний, таких как COVID-19. Такие клинико-генетические сопоставления чрезвычайно важны для выяснения физиологической роли MBL2, фиколинов и MASP-2, а выявленные нами генетические особенности этнически изолированных коренных арктических популяций Красноярского края предоставляют уникальный шанс для проведения такого исследования.

×

About the authors

Marina V. Smolnikova

Research Institute of Medical Problems of the North, Krasnoyarsk Scientific Center, Siberian Branch, Russian Academy of Sciences

Author for correspondence.
Email: smarinv@ya.ru
ORCID iD: 0000-0001-9984-2029

PhD (Biology), Leading Researcher, Head of the Molecular Genetic Research Group

Russian Federation, Krasnoyarsk

M. A. Malinchik

Research Institute of Medical Problems of the North, Krasnoyarsk Scientific Center, Siberian Branch, Russian Academy of Sciences

Email: seapearl1995@gmail.com
ORCID iD: 0000-0002-6350-8616

Junior Researcher

Russian Federation, Krasnoyarsk

S. Y. Tereschenko

Research Institute of Medical Problems of the North, Krasnoyarsk Scientific Center, Siberian Branch, Russian Academy of Sciences

Email: legise@mail.ru
ORCID iD: 0000-0002-1605-7859

PhD, MD (Medicine), Head of the Clinical department of somatic and mental health of children

Russian Federation, Krasnoyarsk

References

  1. Романов А., Беляева Т., Красильщикова И. Частота встречаемости полиморфизма+ 230G/A гена MBL у жителей Санкт-Петербурга // Medline.ru. 2006. Т. 7, № 1. С. 372–377. [Romanov A., Belyaeva T., Krasil’shchikova I. Frequency of occurrence of +230G/A polymorphism of the MBL gene in residents of St. Petersburg. Medline.ru, 2006, vol. 7, no. 1, pp. 372–377. (In Russ.)]
  2. Терещенко С.Ю., Каспаров Э.В., Смольникова М.В., Кувшинова Е.В. Дефицит маннозосвязывающего лектина при заболеваниях респираторного тракта // Пульмонология. 2016. Т. 26, № 6. С. 748–752. [Tereshchenko S.Yu., Kasparov E.V., Smolnikova M.V., Kuvshinova E.V. Mannose-binding lectin deficiency in respiratory diseases. Pulmonologiya = Russian Pulmonology, 2016, vol. 26, no. 6, pp. 748–752. (In Russ.)] doi: 10.18093/0869-0189-2016-26-6-748-752
  3. Терещенко С.Ю., Смольникова М.В. Врожденные дисфункции паттерн-распознающих рецепторов в патогенезе инвазивной и рецидивирующей пневмококковой инфекции у детей // Инфекция и иммунитет. 2019. Т. 9, № 2. С. 229–238. [Tereshchenko S.Yu., Smolnikova M.V. Congenitally impaired pattern-recognition receptors in pathogenesis of pediatric invasive and recurrent pneumococcal infection. Infektsiya i immunitet = Russian Journal of Infection and Immunity, 2019, vol. 9, no. 2, pp. 229–238. (In Russ.)] doi: 10.15789/2220-7619-2019-2-229-238
  4. Bernig T., Breunis W., Brouwer N., Hutchinson A., Welch R., Roos D., Kuijpers T., Chanock S. An analysis of genetic variation across the MBL2 locus in Dutch Caucasians indicates that 3’ haplotypes could modify circulating levels of mannose-binding lectin. Hum. Genet., 2005, vol. 118, no. 3–4, pp. 404–415. doi: 10.1007/s00439-005-0053-5
  5. Bjarnadottir H., Arnardottir M., Ludviksson B.R. Frequency and distribution of FCN2 and FCN3 functional variants among MBL2 genotypes. Immunogenetics, 2016, vol. 68, no. 5, pp. 315–325. doi: 10.1007/s00251-016-0903-4
  6. Bjarnadottir H., Ludviksson B.R. Inherited deficiency of the initiator molecules of the lectin-complement pathway. Laeknabladid, 2010, vol. 96, pp. 611–617. doi: 10.17992/lbl.2010.10.319
  7. Brodszki N., Frazer-Abel A., Grumach A.S., Kirschfink M., Litzman J., Perez E., Seppänen M.R.J., Sullivan K.E., Jolles S. European Society for Immunodeficiencies (ESID) and European Reference Network on Rare Primary Immunodeficiency, Autoinflammatory and Autoimmune Diseases (ERN RITA) Complement Guideline: deficiencies, diagnosis, and management. J. Clin. Immunol., 2020, vol. 40, no. 4, pp. 576–591. doi: 10.1007/s10875-020-00754-1
  8. Cedzynski M., Nuytinck L., Atkinson A.P., Swierzko A.St., Zeman K., Szemraj J., Szala A., Turner M.L., Kilpatrick D.C. Extremes of L-ficolin concentration in children with recurrent infections are associated with single nucleotide polymorphisms in the FCN2 gene. Clin. Exp. Immunol., 2007, vol. 150, no. 1, pp. 99–104. doi: 10.1111/j.1365-2249.2007.03471.x
  9. Chalmers J.D., Mchugh B.J., Doherty C., Smith M.P., Govan J.R., Kilpatrick D.C., Hill A.T. Mannose-binding lectin deficiency and disease severity in non-cystic fibrosis bronchiectasis: a prospective study. Lancet Respir. Med., 2013, vol. 1, no. 3, pp. 224–232. doi: 10.1016/S2213-2600(13)70001-8
  10. Eisen D.P., Osthoff M. If there is an evolutionary selection pressure for the high frequency of MBL2 polymorphisms, what is it? Clin. Exp. Immunol., 2014, vol. 176, no. 2, pp. 165–171. doi: 10.1111/cei.12241
  11. Garcia-Laorden M.I., Sole-Violan J., Rodriguez de Castro F., Aspa J., Briones M.L., Garcia-Saavedra A., Rajas O., Blanquer J., Caballero-Hidalgo A., Marcos-Ramos J.A., Hernandez-Lopez J., Rodriguez-Gallego C. Mannose-binding lectin and mannose-binding lectin-associated serine protease 2 in susceptibility, severity, and outcome of pneumonia in adults. J. Allergy Clin. Immunol., 2008, vol. 122, no. 2, pp. 368–374. doi: 10.1016/j.jaci.2008.05.037
  12. Garred P., Honore C., Ma Y.J., Munthe-Fog L., Hummelshøj T. MBL2, FCN1, FCN2 and FCN3-The genes behind the initiation of the lectin pathway of complement. Mol. Immunol., 2009, vol. 46, no. 14, pp. 2737–2744. doi: 10.1016/j.molimm.2009.05.005
  13. Hegele R.A., Busch C.P., Young T.K., Connelly P.W., Cao H. Mannose-binding lectin gene variation and cardiovascular disease in Canadian Inuit. Clin. Chem., 1999, vol. 45, no. 8, pt 1, pp. 1283–1285.
  14. Hummelshoj T., Munthe-Fog L., Madsen H.O., Fujita T., Matsushita M., Garred P. Polymorphisms in the FCN2 gene determine serum variation and function of Ficolin-2. Hum. Mol. Genet., 2005, vol. 14, pp. 1651–1658. doi: 10.1093/hmg/ddi173
  15. Ip W.K.E., Chan K.H., Law H.K.W., Tso G.H.W., Kong E.K.P., Wong W.H.S., To Y.F., Yung R.W.H., Chow E.Y., Au K.L., Chan E.Y.T., Lim W., Jensenius J.C., Turner M.W., Peiris J.S.M., Lau Y.L. Mannose-binding lectin in severe acute respiratory syndrome coronavirus infection. J. Infect. Dis., 2005, vol. 191, no. 10, pp. 1697–1704. doi: 10.1086/429631
  16. Madsen H.O., Satz M.L., Hogh B., Garred P. Different molecular events result in low protein levels of mannan-binding lectin in populations from southeast Africa and South America. J. Immunol., 1998, vol. 161, no. 6, pp. 3169–3175.
  17. Matricardi P.M., Negro R.W.D., Nisin R. The first, holistic immunological model of COVID-19: Implications for prevention, diagnosis, and public health measures. Pediatr. Allergy Immunol., 2020, vol. 31, no. 5, pp. 454–470. doi: 10.1111/pai.13271
  18. Mishra A., Antony J.S., Sundaravadivel P., Tong H.V., Meyer C.G., Jalli R.D., Velavan T.P., Thangaraj K. Association of ficolin-2 serum levels and FCN2 genetic variants with Indian visceral leishmaniasis. PLoS One, 2015, vol. 10, no. 5: e0125940. doi: 10.1371/journal.pone.0125940
  19. Munthe-Fog L., Hummelshoj T., Hansen B.E., Koch C., Madsen H.O., Skjodt K., Garred P. The impact of FCN2 polymorphisms and haplotypes on the ficolin-2 serum levels. Scand. J. Immunol., 2007, vol. 65, no. 4, pp. 383–392. doi: 10.1111/j.1365-3083.2007.01915.x
  20. Notarangelo L., Casanova J.-L., Fischer A., Puck J., Rosen F., Seger R., Geha R. Primary immunodeficiency diseases: an update. J. Allergy Clin. Immunol., 2004, vol. 114, no. 3, pp. 677–687. doi: 10.1016/j.jaci.2004.06.044
  21. Smolnikova M.V., Freidin M.B., Tereshchenko S.Y. The prevalence of the variants of the L-ficolin gene (FCN2) in the arctic populations of East Siberia. Immunogenetics, 2017, vol. 69, no. 6, pp. 409–413. doi: 10.1007/s00251-017-0984-8
  22. Stengaard-Pedersen K., Thiel S., Gadjeva M., Møller-Kristensen M., Sørensen R., Jensen L.T., Sjøholm A.G., Fugger L., Jensenius J.C. Inherited deficiency of mannan-binding lectin-associated serine protease 2. N. Engl. J. Med., 2003, vol. 349, no. 6, pp. 554–560. doi: 10.1056/NEJMoa022836
  23. Tereshchenko S.Y., Smolnikova M.V., Freidin M.B. Mannose-binding lectin gene polymorphisms in the East Siberia and Russian Arctic populations. Immunogenetics, 2020, vol. 72, no. 6–7, pp. 347–354. doi: 10.1007/s00251-020-01175-5
  24. Thiel S., Kolev M., Degn S., Steffensen R., Hansen A.G., Ruseva M., Jensenius J.C. Polymorphisms in mannan-binding lectin (MBL)-associated serine protease 2 affect stability, binding to MBL, and enzymatic activity. J. Immunol., 2009, vol. 182, pp. 2939–2947. doi: 10.4049/jimmunol.0802053
  25. Thiel S., Steffensen R., Christensen I.J., Ip W.K., Lau Y.L., Reason I.J.M., Eiberg H., Gadjeva M., Ruseva M., Jensenius J.C. Deficiency of mannan-binding lectin associated serine protease-2 due to missense polymorphisms. Genes Immun., 2007, vol. 8, pp. 154–163. doi: 10.1038/sj.gene.6364373
  26. Troldborg A., Hansen A., Hansen S.W., Jensenius J.C., Stengaard-Pedersen K., Thiel S. Lectin complement pathway proteins in healthy individuals. Clin. Exp. Immunol., 2017, vol. 188, no. 1, pp. 138–147. doi: 10.1111/cei.12909

Supplementary files

There are no supplementary files to display.


Copyright (c) 2022 Smolnikova M.V., Malinchik M.A., Tereschenko S.Y.

Creative Commons License
This work is licensed under a Creative Commons Attribution 4.0 International License.

This website uses cookies

You consent to our cookies if you continue to use our website.

About Cookies