Email this article Genetic polymorphisms of helicobacter pylori clinical isolates in St. Petersburg, Russia
- Authors: Svarval A.V.1, Starkova D.A.1, Ferman R.S.1, Narvskaya O.V.1,2
-
Affiliations:
- St. Petersburg Pasteur Institute
- St. Petersburg State Research Institute of Phthisiopulmonology of the Ministry of Health of Russia
- Issue: Vol 12, No 2 (2022)
- Pages: 315-322
- Section: ORIGINAL ARTICLES
- URL: https://iimmun.ru/iimm/article/view/1744
- DOI: https://doi.org/10.15789/2220-7619-GPO-1744
- ID: 1744
Cite item
Full Text
Abstract
Introduction. Helicobacter pylori was proved to be the principal causative agent of gastroduodenal disorders in human. Although Russian Federation is among the countries with a high prevalence of H. pylori infection (60–90%), currently there is a very limited number of studies evaluating H. pylori genotypes in Russia. Objective. Based on the assessment of virulence-associated cagA, oipA, and vacA genes, our study was aimed to determine H. pylori genotypes associated with the clinical outcomes in patients with H. pylori infection in St. Petersburg, Northwest Russia. Materials and methods. Using PCR for the detection of cagA, oipA, and vacA s, m, i allelic variants, we analyzed 61 H. pylori isolates isolated and cultured from biopsies collected during endoscopy of patients with chronic gastritis (G), duodenal ulcer (DU), and gastric cancer (GC). Results. The genetic diversity of H. pylori clinical isolates has been revealed (HGDI 0.88): 41 (67%) of 61 H. pylori isolates were cagA-positive, 38 (62%) — oipA-positive. The proportions of cagA+ isolates differed in patients with G (56.7%) and DU (80.9%) (p = 0.06). The s, m, and i allelic variants of the vacA gene were detected in all strains, although the vacA s1 allele was significantly dominant in patients with DU (95.2%) rather than with G (64.9%) (p = 0.01). The vacA alleles m1 and i1 in the isolates from patients with G and DU were found in almost equal proportions: 45.9% and 42.8% for m1 allele, 45.9% and 47.6% for i1 allele, respectively. Seven isolates (11.5%) were positive for different mixed combinations of vacA alleles s, m, and i. Noteworthy, all vacA s2 strains were cagA-negative and had the m2 allele. OipA+ strains were found in almost equal proportions in patients with G (62.2%) and DU (57.1%) (p = 0.71). All three cagA- and oipA-positive isolates from patients with GC carried vacA s1/m1/i1 alleles. Different combinations of virulence-associated determinants constituted 17 genetic profiles. The most common combined genotype cagA+/oipA+/vacA s1/m1/i1 comprised 18 (29.5%) H. pylori isolates. Conclusion. We have determined predominant genotypes in the H. pylori population in the Northwest of Russia. The significant association between vacA s1 genotype of the pathogen and clinical manifestations of H. pylori infection has been established in our study.
Full Text
Introduction
Helicobacter pylori, a microaerophilic gram-negative spiral-shaped bacteria, infects approximately 4.4 billion humans worldwide. Although most H. pylori-positive individuals remain asymptomatic, the infection may result in the development of gastritis, ulcer disease, gastric adenocarcinoma, and mucosa-associated lymphoid tissue lymphoma [9].
The severity of gastroduodenal lesions in infected individuals depends on the environmental factors, host genetics, and the expression of a large variety of virulence factors in H. pylori strains that play a key role in the development of the infection. Presently, the most intensively studied are the vacuolating cytotoxin (VacA), cytotoxin-associated antigen A (CagA), and outer inflammatory protein (OipA) encoded by vacA, cagA, and oipA genes, respectively [9, 13].
The vacA gene found in the genome of all H. pylori strains encodes a cytotoxin (~140 kDa), inducing the vacuolization of gastric epithelial cells through the formation of anion-selective pores in the cytoplasmic membrane. The genetic diversity of H. pylori strains is associated with vacA allelic variants s (alleles s1/s2), i (alleles i1/i2/i3), and m (alleles m1/m2) due to the mosaic structure of the vacA gene [5, 23]. The product of vacA in H. pylori s1/m1/i1 genotype strains is considered the most cytotoxic and associated with ulcer disease and gastric carcinoma compared with strains of other genotypes [11].
The primary determinant of H. pylori virulence is the cag pathogenicity island (cagPAI) believed to contribute to clinical outcomes, which seems controversial. For instance, a strong association between cagA status and severity of the disease was reported in the developed European countries [15]. In Russia and most Asian countries, such contribution was not proved [18, 21]. The cagPAI genes encode for the type IV secretion system proteins that transport the immunogenic CagA protein to the epithelial cells of the gastric mucosa. Further phosphorylation of CagA by host protein kinases results in the morphological changes in epithelial cells that stimulate ulceration, atrophy, and stomach cancer [8]. The marker of the cagPAI is the cagA gene, which is present in the genome of 25–99% of H. pylori strains depending on their geographical origin [15, 18, 21].
The outer membrane protein OipA, a member of the HOP protein family (Helicobacter outer proteins), is encoded by the oipA gene, which can be functionally active (“on”) or inactive (“off”) due to regulation by the repeated CT motif in the nucleotide sequence. OipA protein provides adhesion of H. pylori to gastric epithelial cells and is associated with interleukin-8 induction and neutrophil infiltration of the gastric mucosa in inflammation and duodenal ulcer [6].
Although Russia belongs to countries with a high prevalence of H. pylori infection (70–90% depending on the region), currently there is a very limited number of studies evaluated H. pylori genotypes in Russia. Based on the assessment of virulence-associated cagA, oipA, and vacA genes, our study was aimed to determine H. pylori genotypes associated with the clinical outcomes in patients with H. pylori infection in St. Petersburg, Northwest Russia.
Materials and methods
Bacterial strains, culture conditions, and identification
A total of 240 patients with a confirmed diagnosis of H. pylori infection from three different hospitals (in St. Petersburg) were recruited between 2014 and 2019. From this cohort, only 122 biopsies from both the corpus and antral mucosa taken during endoscopy from 61 patients were available. The study group included 28 men (45.9%) and 33 women (54.1%). The median age was 44 years (range 17–88 years). Regarding endoscopic findings and histological routine results, 61 patients were distributed into chronic gastritis (n = 37, 60.7%), duodenal ulcer (n = 21, 34.4%) and gastric cancer (n = 3, 4.9%) groups. The retrospective study was approved by the Independent Ethics Committee of St. Petersburg Pasteur Institute, Russia (Protocol No. 50/04-2019, 22.06.2020).
Endoscopic biopsy specimens were homogenized and used for the culture. The H. pylori culture was carried out at St. Petersburg Pasteur Institute (Russia) on a medium containing Columbia agar base with the addition of 5–7% defibrinated horse blood and 1% IsoVitalex solution at 37°C under microaerophilic conditions (oxygen content ~ 5%) using anaerostats of the GasPak 100 System. Visible growth of bacteria was observed after 4–7 days. For primary identification, Gram-stained culture smears were studied by microscopy. The urease, catalase, and oxidase biochemical tests were used for species identification. The strains were identified as H. pylori if all tests were positive. Strain H. pylori NCTC 12823 was used as a reference.
DNA extraction and polymerase chain reaction (PCR) assays
Isolation of chromosomal DNA H. pylori was performed using a set of Helicopol II produced by Litech Laboratories (Moscow).
The PCR for the detection of cagA, oipA, and vacA genes in the DNA samples was performed in the Bio-Rad C1000 Thermal Cycler (USA). The nucleotide sequences of the primers, the annealing temperatures, and the lengths of amplification products are shown in Table 1.
Table 1. Primers used for PCR detection of oipA, cagA, and vacA genes
Genes | Primers | Sequences of primers | Annealing temperature, °C | Length of the PCR product, bp | Reference |
oipA | OipA-F OipA-R | GTTTTTGATGCATGGGATTTGTGCATCTCTTATGGCTTT | 53 | 401 | [29] |
cagA | CagA-F CagA-R | GATAACAGGCAAGCTTTTGAGGCTGCAAAAGATTGTTTGGCAGA | 56 | 349 | [26] |
vacA s1/s2 | VAI-F VAI-R | ATGGAAATACAACAAACACACCTGCTTGAATGCGCCAAAC | 53 | 259/286 | [5] |
vacA m1/m2 | VAG-F VAG-R | CAATCTGTCCAATCAAGCGAGGCGTCAAAATAATTCCAAGG | 52 | 570/645 | [30] |
vacA i1 | VacF1 VacA-C1R | GTTGGGATTGGGGGAATGCCGTTAATTTAACGCTGTTTGAAG | 52 | 426 | [23] |
vacA i2 | VacF1 VacA-C2R | GTTGGGATTGGGGGAATGCCGGATCAACGCTCTGATTTGA | 52 | 432 | [23] |
PCR protocol: 95°C — 3 min.; 35 cycles: 94°С — 35 sec, annealing temperature — 35 sec, 72°С — 45 sec; 72°C — 5 min. PCR products were separated in a 2% agarose gel stained with ethidium bromide. The length of amplification products was determined using molecular weight markers of 50 bp and 100 bp DNA Ladder (LLC Interlabservis, Moscow). The results were visualized using the GelDoc gel documentation system (BioRad, USA).
Statistical analysis
The statistical analysis of group comparison was performed using SPSS for Windows statistical software (version 12; StatSoft Inc., Chicago, IL, USA) and the OpenEpi (a Web-based Epidemiologic and Statistical Calculator for Public Health [www.OpenEpi.com]) for two-by-two tables to calculate the odds ratio (OR) and 95% confidence interval (CI) and the Fisher exact test (one-tailed). A p-value < 0.05 was considered statistically significant.
To quantitatively evaluate the variability of cagA, oipA, and vacA genes, the Hunter–Gaston discriminatory index was calculated (HGDI) using a Discriminatory Power Calculator algorithm (http://insilico.ehu.es/mini_tools/discriminatory_power/index.php).
Results
The culture of biopsies on a selective nutrient medium at 37°C in microaerophilic conditions after 4–7 days resulted in the visible growth of typically small (about 1 mm diameter), round, smooth, transparent, moist colonies containing Gram-negative curved/S-shaped rods. Positive results of biochemical tests (the ability to produce catalase, oxidase, and urease) allowed us to identify 61 bacterial isolates as H. pylori species.
The PCR-based examination of DNA samples revealed the genetic diversity of H. pylori clinical isolates in terms of the presence of virulence-associated genes cagA, oipA, and the distribution of vacA allelic variants (HGDI 0.88) (Table 2). The 41 (67%) of 61 strains were cagA-positive, 38 (62%) — oipA-positive; the vacA gene in various allelic variants was detected in all strains. The s1 (77%), m2 (49%), and i1 (49%) alleles were the most frequent in polymorphic s, m, and i regions of the vacA gene. Seven isolates (11.5%) were positive for different mixed combinations of vacA alleles s, m, and i (Table 2). Such cases may indicate the presence of multiple strains in the human body.
Allelic variants of three regions of the vacA gene were grouped into five genotypes, among them vacA s1/m1/i1 was dominant (41%). The vacA s1/m2/i2 and vacA s2/m2/i2 genotypes included 10 and 12 strains (16% and 20%), respectively. Noteworthy, a rare s2/m1 genotype was not found in our study.
To assess the association of pathogen’s virulence determinants with the severity of gastroduodenal lesions due to H. pylori infection, we analyzed the distribution of cagA, oipA, and vacA genes in H. pylori clinical isolates from patients diagnosed with chronic gastritis (G), duodenal ulcer (DU) and gastric cancer (GC) (Table 2).
Table 2. Genotypes of H. pylori clinical isolates from different patient groups
H. pylori genotype | G, N (%) (n = 37) | DU, N (%) (n = 21) | GC, N (%) (n = 3) | Total, N (%) (n = 61) |
cagA+ | 21 (56.7%) | 17 (80.9%) | 3 (100%) | 41 (67.2%) |
oipA+ | 23 (62.2%) | 12 (57.1%) | 3 (100%) | 38 (62.3%) |
vacA s1 | 24 (64.9%) | 20 (95.2%) | 3 (100%) | 47 (77.0%) |
vacA s2 | 11 (29.7%) | 1 (4.8%) | – | 12 (19.7%) |
vacA s1s2 | 2 (5.4%) | – | – | 2 (3.3%) |
vacA m1 | 17 (45.9%) | 9 (42.8%) | 3 (100%) | 29 (47.5%) |
vacA m2 | 18 (48.6%) | 12 (57.1%) | – | 30 (49.2%) |
vacA m1m2 | 2 (5.4%) | – | – | 2 (3.3%) |
vacA i1 | 17 (45.9%) | 10 (47.6%) | 3 (100%) | 30 (49.2%) |
vacA i2 | 17 (45.9%) | 7 (33.3%) | – | 24 (39.3%) |
vacA i1i2 | 3 (8.1%) | 4 (19.0%) | – | 7 (11.5%) |
vacA s1/m1/i1 | 17 (48.5%) | 11 (47.8%) | 3 (100%) | 31 (50.8%) |
vacA s2/m2/i2 | 11 (31.4%) | 1 (4.3%) | – | 12 (19.7%) |
vacA s1/m2/i2 | 4 (11.4%) | 9 (39.1%) | – | 13 (21.3%) |
vacA s1/m2/i1 | 3 (8.5%) | 2 (8.6%) | – | 5 (8.2%) |
vacA s1/m2/i1i2 | – | 3 (14.3%) | – | 3 (4.9%) |
vacA s1/m1/i1i2 | – | 1 (4.8%) | – | 1 (1.6%) |
vacA s1s2/m1m2/i1i2 | 1 (2.7%) | – | – | 1 (1.6%) |
vacA s1s2/m1/i1i2 | 1 (2.7%) | – | – | 1 (1.6%) |
vacA s1/m1m2/i1i2 | 1 (2.7%) | – | – | 1 (1.6%) |
The proportions of cagA+ H. pylori strains differed depending on the clinical manifestations. In patients with G it was 56.7%, while in patients with DU reached 80.9%, however, the difference was not statistically significant [p = 0.06; OR 3.24 (0.91; 11.52)].
The distribution of strains bearing vacA s1 allele significantly differed in patients with G (64.9%) and DU (95.2%): [p = 0.01; OR 10.833 (1.30; 90.14)]. The vacA alleles m1 and i1 in the isolates from patients with G and DU were found in almost equal proportions: p = 0.82 (for allele m1) and p = 0.90 (for allele i1).
Also, no statistical difference between the oipA status and severity of the disease was detected: the proportions of oipA+ strains in patients with G (62.2%) and DU (57.1%) were almost equal (p = 0.71).
All isolates from patients with GC were cagA-, oipA-positive, and carried vacA s1/m1/i1 alleles (Table 2).
Further analysis of the vacA- and cagA-associated polymorphism in H. pylori clinical isolates revealed a relationship between the cagA+ status and the allelic variant s1 of the vacA gene: among 41 cagA-positive strains 39 (95.1%) possessed the vacA s1 allele (two cagA+ strains had multiple genotype s1s2), while none of the vacA s2 bearing strains carried cagA gene. Noteworthy, all vacA s2 strains had the m2 allele (Table 3). Only 24 (58%) of cagA-positive strains were vacA m1. The majority (88%) of the vacA s1/m1/i1 allelic profile strains were cagA-positive. The majority of oipA-positive isolates (87%) were carriers of the cagA gene.
Table 3. The distribution of vacA and oipA profiles in cagA-positive and cagA-negative H. pylori clinical isolates
H. pylori genotype | cagA+, N (%) (n = 41) | cagA–, N (%) (n = 20) | Total, N (%) (n = 61) |
vacA s1 | 39 (95.1%) | 8 (40.0%) | 47 (77.0%) |
vacA s2 | – | 12 (60.0%) | 12 (19.6%) |
vacA m1 | 24 (58.5%) | 5 (25.0%) | 29 (47.5%) |
vacA m2 | 15 (36.6%) | 15 (75.0%) | 30 (49.2%) |
vacA i1 | 26 (63.4%) | 4 (20.0%) | 30 (49.2%) |
vacA i2 | 8 (19.5%) | 16 (80.0%) | 24 (39.3%) |
vacA s1/m1/i1 | 22 (53.6%) | 3 (15.0%) | 25 (40.9%) |
vacA s1/m2/i1 | 4 (9.7%) | 1 (5.0%) | 5 (8.2%) |
vacA s1/m2/i2 | 8 (19.5%) | 2 (10.0%) | 10 (16.4%) |
vacA s2/m2/i2 | – | 12 (60.0%) | 12 (19.7%) |
oipA+ | 33 (80.5%) | 5 (25.0%) | 38 (62.3%) |
oipA– | 8 (19.5%) | 15 (75.0%) | 23 (37.7%) |
vacA s1s2/m1m2/i1i2 | 1 (2.4%) | – | 1 (1.6%) |
vacA s1s2/m1/i1i2 | 1 (2.4%) | – | 1 (1.6%) |
vacA s1/m1m2/i1i2 | 1 (2.4%) | – | 1 (1.6%) |
vacA s1/m1/i1i2 | 1 (2.4%) | – | 1 (1.6%) |
vacA s1/m2/i1i2 | 3 (7.3%) | – | 3 (4.9%) |
The proportion of cagA+/vacAs1 genotype strains in patients with G reached 51%, compared to larger proportions in patients with DU (81%) and GC (100%). Only one of the 21 isolates from patients with DU had the cagA-/vacAs2 genotype.
Different combinations of cagA/oipA/vacA alleles in 61 clinical H. pylori isolates were grouped in 17 profiles, five of which represented multiple genotypes (Table 4). The most common variant was cagA+/oipA+/vacAs1/m1/i1 which comprised 18 (30%) of the strains isolated from patients with G, DU, and GC. The remaining genotypes were represented by groups, including 1 to 6 strains.
Table 4. Combined genotypes of H. pylori clinical isolates from different patient groups
Combined H. pylori genotypes | G (n = 37) | DU (n = 21) | GC (n = 3) | Total (n = 61) |
cagA+/oipA+/vacA s1/m1/i1 | 10 (27.0%) | 5 (23.8%) | 3 (100%) | 18 (29.5%) |
cagA+/oipA+/vacA s1/m2/i2 | 3 (8.1%) | 3 (14.3%) | – | 6 (9.8%) |
cagA+/oipA+/vacA s1/m2/i1 | 2 (5.4%) | – | – | 2 (3.3%) |
cagA+/oipA–/vacA s1/m1/i1 | 2 (5.4%) | 2 (9.5%) | – | 4 (6.5%) |
cagA+/oipA–/vacA s1/m2/i1 | 1 (2.7%) | 1 (4.8%) | – | 2 (3.3%) |
cagA+/oipA–/vacA s1/m2/i2 | – | 2 (9.5%) | – | 2 (3.3%) |
cagA–/oipA+/vacA s2/m2/i2 | 5 (13.5%) | – | – | 5 (8.2%) |
cagA–/oipA–/vacA s1/m1/i1 | 2 (5.4%) | 1 (4.8%) | – | 3 (4.9%) |
cagA–/oipA–/vacA s1/m1/i2 | 2 (5.4%) | – | – | 2 (3.3%) |
cagA–/oipA–/vacA s1/m2/i2 | 1 (2.7%) | 1 (4.8%) | – | 2 (3.3%) |
cagA–/oipA–/vacA s2/m2/i2 | 6 (16.2%) | 1 (4.8%) | – | 7 (11.5%) |
cagA–/oipA–/vacA s1/m2/i1 | – | 1 (4.8%) | – | 1 (1.6%) |
cagA+/oipA+/vacA s1s2/m1m2/i1i2 | 1 (2.7%) | – | – | 1 (1.6%) |
cagA+/oipA+/vacA s1s2/m1/i1i2 | 1 (2.7%) | – | – | 1 (1.6%) |
cagA+/oipA+/vacA s1/m1m2/i1i2 | 1 (2.7%) | – | – | 1 (1.6%) |
cagA+/oipA+/vacA s1/m1/i1i2 | – | 1 (4.8%) | – | 1 (1.6%) |
cagA+/oipA+/vacA s1/m2/i1i2 | – | 3 (14.3%) | – | 3 (4.9%) |
Discussion
The populations of H. pylori appear heterogenic in different countries with variable ethnic, socioeconomic, and environmental characteristics. The polymorphisms in cagA and vacA genes associated with virulence are widely exploited for the genotyping of H. pylori strains. The presence of the cagA gene (a marker of the pathogenicity island, cagPAI) varies among H. pylori strains of different geographical origin: ~ 80–99% in East Asian countries [14, 21], Southeast and South Asia [20, 22, 27], South Africa [24]; ~ 50–70% in countries of Western Europe [7, 12, 15, 17]; ~ 50% and lower in the countries of the Middle East [10, 19]. According to the studies conducted in the Russian Federation, the presence of cagA-positive H. pylori strains varies in different regions: 80–90% in Moscow (Central region) [18] and Yekaterinburg (Ural Federal District) [3], 70–80% in Rostov-on-Don, Astrakhan (Southern Federal District) [2], 30–60% in Eastern Siberia [25], < 50% in Kazan (Volga Federal District) [1].
In this study, we detected about 67% of cagA- positive H. pylori strains among patients from St. Petersburg, which is consistent with data from Europe. In particular, in Finland, the proportion of cagA+ H. pylori strains reached 66%. The observed similarities may be partly explained by the territorial neighborhood and close communication between St. Petersburg Region, Russia, and Finland.
It is generally accepted that CagA-negative H. pylori strains are less virulent than CagA-positive strains causing severe gastrointestinal lesions in humans. The cagA-positive strains are reported in 80–100% of patients with DU and GC in Europe. In our study, the cagA gene was observed in H. pylori isolates from patients with DU (81%) and GC (100%), which is consistent with the previously published data [7, 15, 17]. In Asia, almost all strains of H. pylori carry the cagA gene, regardless of the infection severity [21], thus emphasizing the role of the CagA protein as a pathogen’s virulence factor.
The vacA gene is known to be present in the genome of all H. pylori strains. However, different levels of cytotoxic activity of the VacA protein are associated with the diversity of allelic variants in the s-, m-, and i-regions of the vacA gene [11, 23].
We have established an association between the vacA s1 allele and DU since only one of the 21 H. pylori strains possessed an alternative vacA s2. Interestingly, that vacA s2 allele was predominant in H. pylori isolates from patients with G (~ 92%). No similar association was found in the m-variants of the vacA gene: the m1 and m2 alleles were distributed almost equally among clinical isolates from patients with G (45.9% and 48.6%, respectively) and DU (42.8% and 57.1%, respectively). In contrast to the widespread opinion on the leading role of the H. pylori vacA s1/m1 genotype in the development of a duodenal ulcer, our data did not confirm such association: we observed almost similar proportions of the s1/m1 and s1/m2 genotypes in patients with DU (42.8% and 52.4%, respectively). However, the s1/m1 genotype was detected in H. pylori isolates from patients with GC (though the number of such isolates was limited to three in our study), which is consistent with the reports from the Netherlands and Portugal [4, 28]. These data suggest a variety of H. pylori virulence determinants associated with the severity of lesions during infection of the gastrointestinal tract.
Polymorphism of the intermediate i region of the vacA gene is determined by alternative alleles i1/i2. According to the published data, the vacA i1 allele appears more informative than the s1/m1 allele and can be considered as an independent “marker” of gastric cancer [14].
We found that all vacA s1/m1 and vacA s2/m2 H. pylori isolates carried the i1 (vacA s1/m1/i1) and i2 (vacA s2/m2/i2) alleles, respectively. On the contrary, vacA s1/m2 genotype isolates appeared heterogeneous in the i-region (vacA s1/m2/i1 and vacA s1/m2/i2), which is in line with other reports [14, 21]. All H. pylori isolates from patients with gastric cancer (n = 3) were carriers of the vacA i1 allele combined with s1/m1. However, there was no correlation of vacA i1 genotype with other forms of H. pylori infection: 45.9% vacA i1 isolates from patients with G versus 47.6% from patients with DU. Thus, a large-scale assessment of the vacA i1 allele as a putative marker of predisposition to gastric cancer is necessary.
Based on the vacA genotyping, our results suggest the coexistence of multiple genetically different H. pylori strains in various gastric sites resulting from the mixt infection in a considerable number of patients (7/61, 11.5%).
An analysis of the H. pylori cagA and vacA combined genotypes demonstrated, firstly, the association of the cagPAI region with the vacA s1 allele and the absence of cagPAI in vacA s2 strains; secondly, the association of DU with the vacA s1 genotype. The vacA s2 strains were unique for patients with G. These data support the generally accepted opinion that vacA s1 strains increase the risk of developing DU and GC, while vacA s2 strains are less virulent and rarely associated with the progress of H. pylori infection. The vacA i1 and vacA m1 genotypes of H. pylori isolates were not associated with DU.
It is believed that the functionally active oipA gene is associated with the presence of the cagA gene, which, in turn, is associated with the H. pylori vacA s-region [16, 30]. However, their relationships remain unclear, taking into account the mutual remoteness of the oipA, cagA, and vacA genes on the bacterial chromosome.
In our study, a functionally active oipA+ gene was found in 62% of H. pylori isolates, while several studies reported the presence of the oipA gene in 90–100% strains [6, 16]. Most oipA-positive isolates (80%) carried the cagA gene. We did not find links between the presence of oipA gene and H. pylori-mediated diseases: the frequency of oipA+ strains in patients with G and DU was similar (60%). At the same time, the oipA+ isolates have predominated in patients with GC (100%), though the low number of gastric cancer cases in our study did not allow us to confirm an association.
The present study revealed the dominant combined genotype cagA+/oipA+/vacA s1/m1/i1 in H. pylori clinical isolates (30%). Our results inspire to search for reliable genetic markers associated with various clinical manifestations of H. pylori infection.
Conclusion
In conclusion, the PCR-based analysis of virulence determinants in clinical isolates revealed heterogeneity and the predominant genotypes in the H. pylori population in St. Petersburg, Russia. Although Russia belongs to countries with a high prevalence of H. pylori infection, a relatively low proportion of the cagA-bearing isolates were detected, and they were not significantly associated with duodenal ulcer. The significant association between the vacA s1 genotype of the pathogen and clinical manifestations of H. pylori infection has been established. Despite the limitations in the number of specimens, this finding may serve as a potential predictor for the H. pylori disease progression. A large-scale assessment is a demand to reveal the actual risk in developing gastroduodenal diseases due to H. pylori infection in Russia. In general, our study gained new insights into the H. pylori genetic structure in St. Petersburg, thus contributing to Russian and global pathogen population characterizations.
About the authors
A. V. Svarval
St. Petersburg Pasteur Institute
Email: alena.svarval@mail.ru
ORCID iD: 0000-0001-9340-4132
PhD (Medicine), Senior Researcher, Head of the Pathogens Identification Laboratory
Russian Federation, 197101, St. Petersburg, Mira str., 14Daria A. Starkova
St. Petersburg Pasteur Institute
Email: dariastarkova13@gmail.com
ORCID iD: 0000-0003-3199-8689
PhD (Biology), Senior Researcher of the Pathogens Identification Laboratory, Researcher of the Laboratory of Molecular Epidemiology and Evolutionary Genetics
Russian Federation, 197101, St. Petersburg, Mira str., 14R. S. Ferman
St. Petersburg Pasteur Institute
Email: laborimmun@mail.ru
ORCID iD: 0000-0001-7661-3725
Junior Researcher, Pathogens Identification Laboratory
Russian Federation, 197101, St. Petersburg, Mira str., 14O. V. Narvskaya
St. Petersburg Pasteur Institute; St. Petersburg State Research Institute of Phthisiopulmonology of the Ministry of Health of Russia
Author for correspondence.
Email: onarvskaya@gmail.com
ORCID iD: 0000-0002-0830-5808
PhD, MD (Medicine), Professor, Leading Researcher, Laboratory of Molecular Epidemiology and Evolutionary Genetics, Academic Adviser
Russian Federation, 197101, St. Petersburg, Mira str., 14; St. PetersburgReferences
- Ахтереева А.Р., Давидюк Ю.Н., Файзуллина Р.А., Ивановская К.А., Сафин А.Г., Сафина Д.Д., Абдулхаков С.Р. Распространенность генотипов Helicobacter pylori у пациентов с гастродуоденальной патологией в Казани // Казанский медицинский журнал. 2017. Т. 98, № 5. C. 723–728. [Akhtereeva A.R., Davidyuk Y.N., Faizullina R.A., Ivanovskaya K.A., Safin A.G., Safina D.D., Abdulkhakov S.R. Prevalence of Helicobacter pylori genotypes in patients with gastroduodenal pathology in Kazan. Kazanskiy meditsinskiy zhurnal = Kazan Medical Journal, 2017, vol. 98, no. 5, pp. 723–728. (In Russ.)] doi: 10.17750/KMJ2017-723
- Сорокин В.М., Писанов Р.В., Водопьянов А.С., Голубкина Е.В., Березняк Е.А. Сравнительный анализ генотипов штаммов Helicobacter pylori в Ростовской и Астраханской области // Медицинский вестник Юга России. 2018. Т. 9, № 4. С. 81–86. [Sorokin V.M., Pisanov R.V., Vodop’janov A.S., Golubkina E.V., Bereznjak E.A. Comparative analysis of genotypes of Helicobacter pylori strains in the Rostov and Astrakhan regions. Medicinskij vestnik Yuga Rossii = Medical Herald of the South of Russia, 2018, vol. 9, no. 4, pp. 81–86. (In Russ.)] doi: 10.21886/2219-8075-2018-9-4-81-86
- Щанова Н.О., Прохорова Л.В. Возможности повышения эффективности эрадикации Helicobacter pylori у больных язвенной болезнью желудка и двенадцатиперстной кишки // Российский журнал гастроэнтерологии, гепатологии, колопроктологии. 2016. № 2. С. 11–18. [Schanova N.O., Prokhorova L.V. Improvement of Helicobacter pylori eradication efficacy at stomach and duodenum peptic ulcers. Rossiiskii zhurnal gastroenterologii, gepatologii, koloproktologii = Russian Journal of Gastroenterology, Hepatology, Coloproctology, 2016, no. 2, pp. 11–18. (In Russ.)]
- Almeida N., Donato M.M., Romãozinho J.M., Luxo C., Cardoso O., Cipriano M.A., Marinho C., Fernandes A., Sofia C. Correlation of Helicobacter pylori genotypes with gastric histopathology in the central region of a South-European country. Dig. Dis. Sci., 2015, vol. 60, no. 1, pp. 74–85. doi: 10.1007/s10620-014-3319-8
- Atherton J.C., Cao P., Peek R.M., Tummuru M.K., Blaser M.J., Cover T.L. Mosaicism in vacuolating cytotoxin alleles of Helicobacter pylori. Association of specific vacA types with cytotoxin production and peptic ulceration. J. Biol. Chem., 1995, vol. 270, pp. 17771–17777. doi: 10.1074/jbc.270.30.17771
- Braga L.L.B.C., Batista M.H.R., de Azevedo O.G.R., da Silva Costa K.C., Gomes A.D., Rocha G.A., Queiroz D.M.M. OipA “on” status of Helicobacter pylori is associated with gastric cancer in North-Eastern Brazil. BMC Cancer, 2019, vol. 19, no. 1: 48. doi: 10.1186/s12885-018-5249-x
- Chiarini A., Calà C., Bonura C., Gullo A., Giuliana G., Peralta S., D’Arpa F., Giammanco A. Prevalence of virulence-associated genotypes of Helicobacter pylori and correlation with severity of gastric pathology in patients from western Sicily, Italy. Eur. J. Clin. Microbiol. Infect. Dis., 2009, vol. 28, pp. 437–446. doi: 10.1007/s10096-008-0644-x
- Da Costa D.M., Pereira Edos S., Rabenhorst S.H. What exists beyond cagA and vacA? Helicobacter pylori genes in gastric diseases. World J. Gastroenterol., 2015, vol. 21, no. 37, pp. 10563–10572. doi: 10.3748/wjg.v21.i37.10563
- De Brito B.B., da Silva F.A.F., Soares A.S., Pereira V.A., Santos M.L.C., Sampaio M.M., Neves P.H.M., de Melo F.F. Pathogenesis and clinical management of Helicobacter pylori gastric infection. World. J. Gastroenterol., 2019, vol. 25, no. 37, pp. 5578–5589. doi: 10.3748/wjg.v25.i37.5578
- Diab M., Shemis M., Gamal D., El-Shenawy A., El-Ghannam M., El-Sherbini E. Helicobacter pylori Western cagA genotype in Egyptian patients with upper gastrointestinal disease. EJMHG, 2018, vol. 19, no. 4, pp. 297–300. doi: 10.1016/j.ejmhg.2018.06.003
- Foegeding N.J., Caston R.R., McClain M.S., Ohi M.D., Cover T.L. An overview of Helicobacter pylori VacA toxin biology. Toxins (Basel), 2016, vol. 8, no. 6: e173. doi: 10.3390/toxins8060173
- Heikkinen M., Mayo K., Mégraud F., Vornanen M., Marin S., Pikkarainen P., Julkunen R. Association of CagA-positive and CagA-negative Helicobacter pylori strains with patients’ symptoms and gastritis in primary care patients with functional upper abdominal complaints. Scand. J. Gastroenterol., 1998, vol. 33, no. 1, pp. 31–38. doi: 10.1080/00365529850166176
- Imkamp F., Lauener F.N., Pohl D., Lehours P., Vale F.F., Jehanne Q., Zbinden R., Keller P.M., Wagner K. Rapid characterization of virulence determinants in Helicobacter pylori isolated from non-atrophic gastritis patients by next-generation sequencing. J. Clin. Med., 2019, vol. 8, no. 7: 1030. doi: 10.3390/jcm8071030
- Inagaki T., Nishiumi S., Ito Y., Yamakawa A., Yamazaki Y., Yoshida M., Azuma T. Associations between cagA, vacA, and the clinical outcomes of Helicobacter pylori infections in Okinawa, Japan. Kobe J. Med. Sci., 2017, vol. 63, no. 2, pp. 58–67.
- Kamogawa-Schifter Y., Yamaoka Y., Uchida T., Beer A., Tribl B., Schöniger-Hekele M., Trauner M., Dolak W. Prevalence of Helicobacter pylori and its CagA subtypes in gastric cancer and duodenal ulcer at an Austrian tertiary referral center over 25 years. PLoS One, 2018, vol. 13, no. 5: e0197695. doi: 10.1371/journal.pone.0197695
- Liu J., He C., Chen M., Wang Z., Xing C., Yuan Y. Association of presence/absence and on/off patterns of Helicobacter pylori oipA gene with peptic ulcer disease and gastric cancer risks: a meta-analysis. BMC Infect. Dis., 2013, 13: 555. doi: 10.1186/1471-2334-13-555
- Miehlke S., Kirsch C., Agha-Amiri K., Günther T., Lehn N., Malfertheiner P., Stolte M., Ehninger G., Bayerdörffer E. The Helicobacter pylori vacA s1, m1 genotype and cagA is associated with gastric carcinoma in Germany. Int. J. Cancer, 2000, vol. 87, no. 3, pp. 322–327.
- Momynaliev K., Smirnova O., Kudryavtseva L., Govorun V. Helicobacter pylori genotypes in Russia. Eur. J. Clin. Microbiol. Infect. Dis., 2003, vol. 22, no. 9, pp. 573–574. doi: 10.1007/s10096-003-0987-2
- Muhsen K., Sinnereich R., Beer-Davidson G., Nassar H., Abu Ahmed W., Cohen D., Kark J.D. Correlates of infection with Helicobacter pylori positive and negative cytotoxin-associated gene A phenotypes among Arab and Jewish residents of Jerusalem. Epidemiol. Infect., 2019, vol. 147: e276. doi: 10.1017/S0950268819001456
- Mukhopadhyay A.K., Kersulyte D., Jeong J.Y., Datta S., Ito Y., Chowdhury A., Santra A., Bhattacharya S.K., Azuma T., Nair G.B., Berg D.E. Distinctiveness of genotypes of Helicobacter pylori in Calcutta, India. J. Bacteriol., 2000, vol. 182, no. 11, pp. 3219–3227. doi: 10.1128/jb.182.11.3219-3227.2000
- Nguyen L.T., Uchida T., Murakami K., Fujioka T., Moriyama M. Helicobacter pylori virulence and the diversity of gastric cancer in Asia. J. Med. Microbiol., 2008, vol. 57, no. 12, pp. 1445–1453. doi: 10.1099/jmm.0.2008/003160-0
- Rahman M., Mukhopadhyay A.K., Nahar S., Datta S., Ahmad M.M., Sarker S., Masud I.M., Engstrand L., Albert M.J., Nair G.B., Berg D.E. DNA-level characterization of Helicobacter pylori strains from patients with overt disease and with benign infections in Bangladesh. J. Clin. Microbiol., 2003, vol. 41, no. 5, pp. 2008–2014. doi: 10.1128/jcm.41.5.2008-2014.2003
- Rhead J.L., Letley D.P., Mohammadi M., Hussein N., Mohagheghi M.A., Eshagh Hosseini M., Atherton J.C. A new Helicobacter pylori vacuolating cytotoxin determinant, the intermediate region, is associated with gastric cancer. Gastroenterology, 2007, vol. 133, no. 3, pp. 926–936. doi: 10.1053/j.gastro.2007.06.056
- Tanih N.F., McMillan M., Naidoo N., Ndip L.M., Weaver L.T., Ndip R.N. Prevalence of Helicobacter pylori vacA, cagA and iceA genotypes in South African patients with upper gastrointestinal diseases. Acta Trop., 2010, vol. 116, no. 1, pp. 68–73. doi: 10.1016/ j.actatropica.2010.05.011
- Tsukanov V.V., Butorin N.N., Maady A.S., Shtygasheva O.V., Amelchugova O.S., Tonkikh J.L., Fassan M., Rugge M. Helicobacter pylori infection, intestinal metaplasia, and gastric cancer risk in Eastern Siberia. Helicobacter, 2011, vol. 16, no. 2, pp. 107–112. doi: 10.1111/j.1523-5378.2011.00827.x
- Tumurru M.K., Cover T.L., Blaser M.J. Cloning and expression of a high-molecular mass major antigen of Helicobacter pylori: evidence of linkage to cytotoxin production. Infect. Immun., 1993, vol. 61, pp. 1799–1809.
- Uchida T., Miftahussurur M., Pittayanon R., Vilaichone R.K., Wisedopas N., Ratanachu-Ek T., Kishida T., Moriyama M., Yamaoka Y., Mahachai V. Helicobacter pylori Infection in Thailand: A Nationwide Study of the CagA Phenotype. PLoS One, 2015, vol. 10, no. 9: e0136775. doi: 10.1371/journal.pone.0136775
- Van Doorn L.J., Figueiredo C., Mégraud F., Pena S., Midolo P., Queiroz D.M., Carneiro F., Vanderborght B., Pegado M.D., Sanna R., De Boer W., Schneeberger P.M., Correa P., Ng E.K., Atherton J., Blaser M.J., Quint W.G. Geographic distribution of vacA allelic types of Helicobacter pylori. Gastroenter., 1999, vol. 116, no. 4, pp. 823–830. doi: 10.1016/s0016-5085(99)70065-x
- Versalovic J., Koeuth T., Lupski J.R. Distribution of repetitive DNA sequences in Eubacteria and application to fingerprinting of bacterial genomes. Nucleic Acids Res., 1991, vol. 19, pp. 6823–6831. doi: 10.1093/nar/19.24.6823
- Yamaoka Y., Kodama T., Gutierrez O., Kim J.G., Kashima K., Graham D.Y. Relationship between Helicobacter pylori iceA, cagA, and vacA status and clinical outcome: studies in four different countries. J. Clin. Microbiol., 1999, vol. 37, pp. 2274–2279.
Supplementary files
СМИ зарегистрировано Федеральной службой по надзору в сфере связи, информационных технологий и массовых коммуникаций (Роскомнадзор).