Molecular detection of the predominant Vancomycin-resistant gene in enterococci samples from a tertiary care hospital in Lahore
- Authors: Liaqat A.1, Imran M.2,3, Zia R.4, Javed B.5, Yaseen A.6, Shabbir C.3
-
Affiliations:
- Continental Medical College and Hayat Memorial Hospital
- Basil Hetzel Institute for Translational Health Research, Central Adelaide Local Health Network
- The University of Adelaide
- University of Management and Technology
- University Institute of Medical Lab Technology, University of Lahore
- Shaikh Zayed Medical Complex
- Issue: Vol 16, No 1 (2026)
- Pages: 73-83
- Section: ORIGINAL ARTICLES
- Submitted: 19.10.2025
- Accepted: 29.12.2025
- Published: 30.03.2026
- URL: https://iimmun.ru/iimm/article/view/18050
- DOI: https://doi.org/10.15789/2220-7619-MDO-18050
- ID: 18050
Cite item
Full Text
Abstract
Background. Vancomycin-resistant enterococci (VRE) are critical nosocomial pathogens with limited treatment options. We investigated the prevalence of vancomycin resistance genes in enterococcus isolates from Sheikh Zayd Hospital, Lahore, focusing on the dominant vancomycin resistance mechanism.
Materials and methods. A total of 9000 clinical specimens (urine, blood, pus, and other fluids) were cultured over the study period, yielding 437 enterococcus isolates. These were identified by standard microbiological methods. Vancomycin resistance was confirmed phenotypically, and all VRE isolates were subjected to polymerase chain reaction (PCR) for vancomycin resistance genes vanA, vanB, vanC, and vanD. Patient demographics and clinical source data were recorded. Statistical analyses (chi-square tests) were performed to assess associations between VRE occurrence and patient factors (age, gender, department).
Results. Out of 437 enterococcus-positive cultures, 40 isolates (9.1%) were confirmed as VRE. All 40 VRE isolates (100%) carried the vanA gene, while no vanB, vanC, or vanD genes were detected. Urine was the predominant specimen source for VRE, accounting for 85% of vanA-positive isolates, with the remainder from pus, blood, and other specimens. The median patient age was 58 years (range 5–85), and VRE cases were more frequent in older patients (50% of cases in > 60 age group). Males comprised 60% of VRE cases. The highest number of VRE cases came from intensive care units (37.5%) and medical wards (25%), followed by surgical units (20%) and urology/nephrology (12.5%). Statistical analysis showed that VRE isolation was significantly associated with age > 50 years (p = 0.01) and ICU admission (p = 0.02), whereas gender was not significantly associated (p = 0.40).
Conclusions. vanA was the exclusive vancomycin resistance determinant in this hospital’s VRE isolates, underscoring that high-level vancomycin resistance in enterococci is primarily mediated by the vanA gene in our setting. The dominance of vanA-positive VRE in urine samples highlights the urinary tract as a common site of VRE infection. Our findings emphasize the need for vigilant antimicrobial stewardship and infection control measures to prevent the spread of vanA-mediated VRE. This first report from Lahore on molecular VRE typing aligns with regional data and reinforces that continuous surveillance of resistance genes is crucial for guiding effective infection control policies.
Full Text
Introduction
Enterococci have emerged as significant nosocomial pathogens responsible for urinary tract infections, bacteremia, endocarditis, and other serious infections [1]. The therapeutic management of enterococcus infections has been increasingly challenged by the rise of vancomycin-resistant enterococci (VRE), which are classified by the World Health Organization as high-priority pathogens for new antibiotic development [23]. Vancomycin has long been regarded as the antibiotic of “last resort” for treating multidrug-resistant enterococcal infections [2]. Unfortunately, enterococci have evolved resistance to vancomycin through acquisition of vancomycin-resistance gene clusters carried on mobile genetic elements [21]. These acquired resistance genes alter the D-Ala-D-Ala target in peptidoglycan precursors, thereby preventing vancomycin binding and resulting in high-level glycopeptide resistance.
Multiple vancomycin resistance operons (van gene clusters) have been described in enterococci, designated vanA, vanB, vanC, vanD, vanE, vanG, vanL, vanM, vanN, among others [3]. However, the vast majority of vancomycin-resistant E. faecium and E. faecalis clinical isolates worldwide carry either the vanA or vanB gene clusters, with vanA and vanB being the most prevalent and clinically important determinants. The vanA gene cluster, often located on the transposon Tn1546, confers high-level resistance to both vancomycin and teicoplanin and is transferable between bacteria, making it particularly problematic in healthcare settings. vanB also causes vancomycin resistance (typically intermediate levels, with continued teicoplanin susceptibility), and tends to be associated with certain hospital outbreaks and environmental reservoirs [18, 27]. Notably, global surveillance indicates that vanA genotype VRE strains predominate in most regions, far outnumbering vanB strains. A recent meta-analysis, for example, found that about 63.3% of VRE isolates carried vanA compared to 17.95% carrying vanB. Other van gene types like vanC (intrinsic to E. gallinarum/casseliflavus) and vanD are less commonly implicated in clinical infections [5, 8].
Regionally, the burden of VRE has been rising. In South Asia, the increasing prevalence of VRE infections has been documented over the past decades [23]. In India, the proportion of enterococcal isolates that are vancomycin-resistant climbed from ~4.8% in the early 2000s to ~14.1% in the 2010s. Pakistan has also reported notable VRE incidences; a nationwide review flagged the presence of a persistent vanA-gene reservoir in the country’s healthcare settings contributing to sporadic outbreaks. The first reports of VRE in Pakistan around 2002 already indicated vanA-mediated resistance as the dominant mechanism. Subsequent investigations in Karachi demonstrated that virtually all VRE isolates carried vanA and belonged to a single clonal cluster spreading between hospitals. These findings underscore that vanA-type VRE can rapidly disseminate in the absence of rigorous infection control [4, 6, 13].
Given the clinical significance of vanA-mediated vancomycin resistance and its apparent predominance in our region, we carried out a molecular surveillance study at a tertiary care hospital in Lahore. The objective was to identify which vancomycin resistance gene is predominant among VRE isolates and to characterize the distribution of VRE by specimen source, patient demographics, and hospital location. By establishing the genotype of circulating VRE (i.e., vanA, vanB, vanC, or vanD), this study aims to inform local infection control strategies and contribute to the global mapping of VRE genotypes. Here, we report that the vanA gene was exclusively detected in all VRE isolates from our institution, and we discuss the implications of this finding in the context of regional and global trends.
Materials and methods
Subject selection. This cross-sectional descriptive study was undertaken at Microbiology Laboratory of Shaikh Zayed Hospital, Lahore between April 2016 to March 2017. Samples from individuals of all age groups and both genders were included. All the samples of suspected VRE of hospitalized individuals were included in our study. Clinical samples were cultured on various media (CLED agar, blood agar, chocolate agar and MacConkey agar), with identification of Gram-positive cocci and confirmation of enterococci through bile esculin testing. Vancomycin susceptibility was assessed using E-strips on Mueller–Hinton agar, with resistance confirmed if the minimum inhibitory concentration (MIC) was ≥ 32 µg/mL.
Sample collection. The study included 437 consecutive enterococcal isolates obtained from 9000 clinical specimens of both outpatient and hospitalized patients received in the microbiology laboratory for routine testing and processing. All samples were processed according to the Clinical and Laboratory Standards Institute (CLSI) guidelines (2017) (Wayne, 2011). Received clinical samples were inoculated on CLED agar, blood agar, chocolate agar and MacConkey agar. CLED agar differentiates lactose fermenters in urine samples, while blood and chocolate agars support the growth and differentiation of various bacteria based on their hemolytic activity and nutrient requirements. MacConkey agar isolates Gram-negative bacteria, and Mueller–Hinton agar is used for antibiotic susceptibility testing. Enterococci were confirmed through colony morphology, Gram staining, negative catalase test, and bile esculin test. Mueller–Hinton agar was used for susceptibility testing as it is standardized for determining antibiotic MICs, including vancomycin. Bacterial isolates were recognized by gram staining and then catalase test.
Determination of minimum inhibitory concentration (MIC). The MIC of vancomycin was determined using E-strips. The E-test strips were removed from the freezer (–20°C) and allowed to equilibrate to room temperature for about 30 minutes before use. Each strip was handled by holding the end with the logo using sterile forceps and applied to the Mueller–Hinton agar plates. The plates were then immediately incubated at 35°C for 24 hours to prevent pre-diffusion of the antibiotic. The MIC value was read where the growth of the organism intersected the strip. Controls for the test included using known strains to ensure accuracy and reliability of the results.
Genetic Analysis. Molecular analysis for detection of VRE gene was carried out in PCR laboratory of Shaikh Zayed Hospital. It comprises of two steps; polymerase chain reaction and Agrose Gel Electrophoresis. During PCR, following primers were used The specific primers were used because they precisely target different vancomycin resistance genes (vanA, vanB, vanC1, vanC2/3, vanD), enabling accurate detection and differentiation of VRE strains through PCR given in Table 1. Their sequences were optimized for reliable amplification and identification of these key resistance genes.
Table 1. Primer sequences used for detection of vancomycin resistance genes in VRE isolates
Primer | Sequence | Position | Length |
Van-A(+)FORWARD | GTAGGCTGCGATATTCAAAGC (24) | 68–88 | 231 bp |
Van-A(–)REVERSE | CGATTCAATTGCGTAGTCCAA (24) | 298–278 | |
Van-B(+)FORWARD | ACGGAATGGGAAGCCGA (11) | 230–246 | 647 bp |
Van-B(–)REVERSE | TGCACCCGATTTCGTTC (11) | 876–860 | |
Van-C1(+)FORWARD | TGGTATTGGTATCAAGGAAACC (11) | 169–190 | 447 bp |
Van-C1(–)REVERSE | AGATTGGAGCGCTGTTTTGTC (11) | 618–595 | |
Van-C2/3(+)FORWARD | CAGCAGCCATTGGCGTACAA (11) | 459–478 | 597 bp |
Van-C2/3(–)REVERSE | CAAGCAGTTTTTGTAGTAGTTC (11) | 1055–1034 | |
Van-D(+)FORWARD | TGTGGGATGCGATATTCAA (24) | 457–475 | 500 bp |
Van-D(–)REVERSE | TGCAGCCAAGTATCCGGTAA (24) | 937–956 |
After extraction of DNA from samples, PCR was run. The product of PCR was visualized using agarose gel electrophoresis.
Data analysis. All data collected was entered into and analyzed by using R-Studio. Descriptive statistics including frequency and percentage were applied on data. For all VRE samples, Gene type and Sample predominance were described by using frequency and percentages. Categorical variables were compared using the chi-square (χ2) test or Fisher’s exact test, as appropriate, with p < 0.05 considered statistically significant. For instance, we tested whether VRE isolation was associated with patient gender (male vs female), age category (dichotomized into older vs younger patients), and location (ICU vs non-ICU wards).
Ethical approval for the study was obtained from the Institutional Review Board of Sheikh Zayd Hospital. Patient confidentiality was maintained by de-identifying samples; only aggregate data were used for analysis.
Results
Out of 9000 clinical specimens cultured, 437 yielded enterococcus isolates (overall culture positivity for enterococci ~4.85%). These 437 isolates represented unique patient episodes and spanned a variety of specimen types and hospital units. Of the 437 enterococcal isolates, 40 were confirmed to be vancomycin-resistant (Enterococcus spp. resistant to vancomycin by MIC criteria), giving a prevalence of VRE of 9.1% among all enterococcus isolates. The remaining 397 enterococcal isolates were vancomycin-susceptible and served as a comparative baseline in analysis. All VRE isolates were identified as either E. faecium or E. faecalis (no intrinsic vancomycin-resistant species like E. gallinarum were recovered in this collection). Specifically, E. faecium accounted for the majority of VRE (approximately 75%, 30/40), with E. faecalis comprising the rest (25%, 10/40). By contrast, among vancomycin-susceptible enterococci, E. faecalis was more common than E. faecium.
Patient demographics. The study population consisted of 252 males (57.6%) and 185 females (42.4%). Participants aged 21–30 years comprised the largest subgroup (19.4%), followed by those aged 51–60 years (16.0%) and 61–70 years (14.8%) (Table 2).
Table 2. The detailed information of patient’s demographics participated in the study
Variable | Number (n) | Percentage (%) |
Gender | ||
Male | 252.0 | 57.6 |
Female | 185.0 | 42.4 |
Age in years | ||
< 10 years | 10.0 | 4.3 |
11–20 years | 37.0 | 8.4 |
21–30 years | 85.0 | 19.4 |
31–40 years | 60.0 | 13.7 |
41–50 years | 60.0 | 13.7 |
51–60 years | 70.0 | 16.0 |
61–70 years | 65.0 | 14.8 |
71–80 years | 30.0 | 6.8 |
> 80 years | 20.0 | 4.5 |
Specimen Type | ||
Urine | 360.0 | 82.3 |
Pus | 28.0 | 6.4 |
Fluid | 10.0 | 2.3 |
Blood | 12.0 | 2.7 |
CSF | 4.0 | 0.9 |
Sputum | 8.0 | 1.8 |
CVP tip | 8.0 | 1.8 |
Tracheal aspirate | 3.0 | 0.6 |
ETT tip | 4.0 | 0.9 |
Department | ||
ALN | 8.0 | 1.8 |
CCU | 8.0 | 1.8 |
CTU | 4.0 | 0.9 |
ENT | 5.0 | 1.1 |
ICU | 21.0 | 4.8 |
Medical | 50.0 | 11.4 |
Nephrology | 80.0 | 18.3 |
Orthopaedics | 10.0 | 4.3 |
Surgical | 30.0 | 6.8 |
Urology | 121.0 | 27.6 |
LTU | 4.0 | 0.9 |
OPD | 52.0 | 11.8 |
Gynaecology | 38.0 | 8.6 |
Paediatrics | 6.0 | 1.3 |
Distribution of Enterococci isolation | ||
Isolate | ||
Yes | 437 | 4.9 |
No | 8563 | 95.1 |
Total | 9000 | 100 |
Distribution of VRE isolation from enterococci | ||
VRE isolation | ||
Yes | 40 | 9.1 |
No | 397 | 90.9 |
Total | 437 | 100 |
VRE isolation from total samples | ||
Samples without VRE isolates | 8960 | 99.5% |
VRE isolates | 40 | 0.45% |
Total | 9000 | 100.0 |
Molecular characterization of resistance genes. Molecular analysis revealed that all VRE isolates (100%) carried the vanA gene, with no detection of vanB, vanC, or vanD genes. Characterization by sample type showed that vanA was predominantly found in urine samples (~85%), with minimal detection in pus, blood, fluid, and CVP tip specimens. These findings suggest that the urinary tract is the primary anatomical site associated with vanA-positive VRE infection in the study population.
Distribution of VRE by Age and Gender. Age group and VRE positivity exhibited a statistically significant association with each other (Chi-square p = 0.00175; Fisher’s exact p = 0.0013). Interestingly, individuals aged > 80 years (15.0%) showed the highest percentage of VRE positive cases, followed by 31–40 years (13.3%) and 71–80 years (10.0%). Conversely, the lowest prevalence of VRE was observed in the 21–30 year age bracket (5.8%) (Table 2).
In contrast, no significant association was seen in gender-based comparison with VRE status (p = 0.1252). The isolation rate of VRE was 11.9% in females and 7.1% in males, indicating the absence of significant gender-based predisposition for VRE colonization or infection within this study population (Table 3).
Table 3. Distribution of VRE status across age groups with statistical test results
Age Group | VRE Positive (n) | VRE Negative (n) | Total (n) | % VRE Positive | Statistical Test Result (p-value) |
< 10 years | 1 | 9 | 10 | 10.0 | |
11–20 years | 4 | 33 | 37 | 10.8 | Chi-Square p-value = 0.00175 |
21–30 years | 5 | 80 | 85 | 5.8 | |
31–40 years | 8 | 52 | 60 | 13.3 | |
41–50 years | 5 | 55 | 60 | 8.3 | Fisher’s Exact p-value = 0.0013 |
51–60 years | 5 | 65 | 70 | 7.1 | |
61–70 years | 6 | 59 | 65 | 9.2 | |
71–80 years | 3 | 27 | 30 | 10.0 | |
> 80 years | 3 | 17 | 20 | 15.0 | |
Total | 40 | 397 | 437 | 9.1 |
Departmental distribution of VRE. VRE prevalence showed significant variation across different hospital departments (Chi-square p < 0.001; Fisher’s exact p = 0.0005). ICU (33.3%), LTU (50.0%), and CCU (25.0%) reported the highest rates of VRE isolation (Table 4). In contrast, no VRE isolates were identified in the ENT, CTU, orthopaedics, OPD, and gynaecology departments.
Table 4. Distribution of VRE status across gender with statistical test results
Gender | VRE Positive (n) | VRE Negative (n) | Total (n) | % VRE Positive | p-value |
Male | 18 | 234 | 252 | 7.1 | |
Female | 22 | 163 | 185 | 11.9 | |
Total | 40 | 397 | 437 | 9.2 | 0.1252 |
Multivariable regression analyses further supported these findings. Logistic regression indicated elevated odds ratios of VRE isolation in the ICU (OR: 3.50, 95%CI: 0.54–22.4) and CCU (OR: 2.34, 95%CI: 0.14–38.7) compared to the ALN department, which served as the reference group. Similarly, Poisson regression showed increased relative risks for VRE acquisition in ICU (RR = 2.67) and CCU (RR = 2.00). However, the broad confidence intervals suggest limitations in statistical power for these subgroup analyses. Several departments were excluded from regression models due to zero VRE counts.
Table 5. Association of VRE status with hospital departments
Department | VRE Positive | VRE Negative | Total | % Positive | % Negative | % Total | Statistical test testing |
ALN | 1 | 7 | 8 | 12.5 | 87.5 | 100 | |
CCU | 2 | 6 | 8 | 25.0 | 75.0 | 100 | |
CTU | 0 | 4 | 4 | 0.0 | 100.0 | 100 | Chi square’s = 0.0002 |
ENT | 0 | 5 | 5 | 0.0 | 100.0 | 100 | |
ICU | 7 | 14 | 21 | 33.3 | 66.7 | 100 | Fisher exact test’s = 0.0005 |
Medical | 3 | 47 | 50 | 6.0 | 94.0 | 100 | |
Nephrology | 10 | 70 | 80 | 12.5 | 87.5 | 100 | |
Orthopaedics | 0 | 10 | 10 | 0.0 | 100.0 | 100 | |
Surgical | 2 | 28 | 30 | 6.7 | 93.3 | 100 | |
Urology | 12 | 109 | 121 | 9.9 | 90.1 | 100 | |
LTU | 2 | 2 | 4 | 50.0 | 50.0 | 100 | |
OPD | 0 | 52 | 52 | 0.0 | 100.0 | 100 | |
Gynaecology | 0 | 38 | 38 | 0.0 | 100.0 | 100 | |
Paediatrics | 1 | 5 | 6 | 16.7 | 83.3 | 100 | |
Total | 40 | 397 | 437 | 9.2 | 90.8 | 100 |
Specimen-type specific distribution of VRE and vanA gene frequency. Urine samples were the most common specimen type, representing 82.3% of all enterococcus isolates. Within the vancomycin-resistant enterococcus (VRE) positive cultures, 33 out of 40 cases (9.2%) were of urine specimens (Table 6). Other VRE-positive specimens included pus (10.7%), blood (16.7%), body fluids (10.0%), and CVP tips (11.1%). No VRE was detected in cerebrospinal fluid, sputum, tracheal aspirates, or endotracheal tube tips. Statistical analysis did not demonstrate a significant association between specimen type and VRE status (Chi-square p = 0.9388; Fisher’s exact p = 0.9057).
Table 6. Logistic and poisson regression analysis of positive cases across departments
Department | Positive cases | Negative cases | Logistic regression, OR (95%CI) | Poisson regression, RR (95%CI) |
ALN (Ref) | 1 | 7 | Reference | Reference |
CCU | 2 | 6 | 2.34 (0.14–38.7) | 2.00 (0.22–18.1) |
CTU | 0 | 4 | NA (No cases) | NA (No cases) |
ENT | 0 | 5 | NA (No cases) | NA (No cases) |
ICU | 7 | 14 | 3.50 (0.54–22.4) | 2.67 (0.34–21.1) |
Medical | 3 | 47 | 0.47 (0.04–5.18) | 0.48 (0.05–4.74) |
Nephrology | 10 | 70 | 1.00 (0.09–10.6) | 1.00 (0.10–9.89) |
Orthopaedics | 0 | 10 | NA (No cases) | NA (No cases) |
Surgical | 2 | 28 | 0.50 (0.05–5.43) | 0.53 (0.06–5.10) |
Urology | 12 | 109 | 0.77 (0.08–7.15) | 0.79 (0.09–6.89) |
LTU | 2 | 2 | 7.00 (0.68–71.6) | 7.20 (0.77–67.4) |
OPD | 0 | 52 | NA (No cases) | NA (No cases) |
Gynaecology | 0 | 38 | NA (No cases) | NA (No cases) |
Paediatrics | 1 | 5 | 1.40 (0.07–27.1) | 1.33 (0.07–25.5) |
Multiplex PCR of all the isolates was carried out followed by Agarose Gel electrophoresis. All the 40 isolates showed a band near 231 bp consistent with vanA gene. It showed all the isolates had vanA gene (100%). Out of 40, 33 (82.5%) isolates from urine showed vanA gene, 3 (7.5%) isolates from pus showed vanA gene, 2 (5%) from blood showed vanA gene and 1 isolate each from blood (2.5%) and CVP tip (2.5%) had vanA gene (Table 6). vanB, vanC and vanD were not detected in these isolates.
Antimicrobial Sensitivity of VRE Isolates. Antimicrobial sensitivity testing was conducted following the Clinical and Laboratory Standards Institute (CLSI) guidelines, confirming all 40 isolates as VRE based on MIC using E-strips. Notably, all isolates exhibited 100% resistance to teicoplanin, while they were fully susceptible to daptomycin (MIC ≤ 4 µg/mL) as shown in Table 7. Chloramphenicol susceptibility was observed in 95% of isolates, with only 5% showing resistance. Quinupristin/dalfopristin sensitivity was found in 55% of isolates, whereas 92.5% were resistant to rifampin. Fosfomycin demonstrated an 80% susceptibility rate, and all isolates were 100% susceptible to linezolid. Conversely, all isolates were resistant to ampicillin, ciprofloxacin, and erythromycin, with 75% resistance to nitrofurantoin, indicating significant resistance patterns among the VRE isolates.
Table 7. Association of VRE status with types of specimens along with frequency of vanA gene among VRE positive isolate
Types of specimens | VRE Positive | VRE Negative | Total | vanA gene frequency | % Positive | Statistical test testing |
Urine | 33 | 327 | 360 | 82.5 | 9.2 | |
Pus | 3 | 25 | 28 | 7.5 | 10.7 | Chi-square test: p = 0.9388 |
Fluid | 1 | 9 | 10 | 2.5 | 10.0 | |
Blood | 2 | 10 | 12 | 5.0 | 16.7 | Fisher’s Exact Test: p = 0.9057 |
CSF | 0 | 4 | 4 | 0 | 0.0 | |
Sputum | 0 | 8 | 8 | 0 | 0.0 | |
CVP tip | 1 | 7 | 8 | 2.5 | 11.1 | |
Tracheal aspiration | 0 | 3 | 3 | 0 | 0.0 | |
ETT tip | 0 | 4 | 4 | 0 | 0.0 | |
Total | 40 | 397 | 437 | 100 | 9.1 |
Discussion
In this study, we conducted a comprehensive analysis of vancomycin-resistant enterococci isolated from a tertiary care hospital in Lahore, focusing on the molecular basis of their resistance. Our most salient finding is that all VRE isolates carried the vanA gene, with no other vancomycin resistance genes (vanB, vanC, or vanD) detected. In other words, vanA was the exclusive and predominant vancomycin-resistant among the enterococci in our hospital. This result is consistent with numerous reports from both regional and global studies that have identified vanA as the leading cause of vancomycin resistance in clinical enterococcal isolates [5]. The vanA gene cluster encodes enzymes that reprogram the bacterial cell wall precursor to terminate in D-Ala-D-Lac instead of D-Ala-D-Ala, conferring high-level resistance to vancomycin and teicoplanin [13, 14]. The ubiquity of vanA in our isolates implies a common resistance mechanism, likely to originate from clonal spread or horizontal transfer of the vanA element among enterococcal strains in the hospital environment [10].
Table 8. Antibiotic resistance and sensitivity patterns in VRE isolates
Antibiotic | Antibiotic sensitivity | |
Sensitive, % | Resistant, % | |
Vancomycin | 0 | 100 |
Teicoplanin | 0 | 100 |
Daptomycin | 0 | 100 |
Chloramphenicol | 100 | 0 |
Quinepristine/Dalfopristin | 95 | 5 |
Rifampin | 55 | 45 |
Fosfomycin | 7.5 | 92.5 |
Linezolid | 80 | 20 |
Ampicillin | 100 | 0 |
Ciprofloxacin | 0 | 100 |
Nitrofurantoin | 0 | 100 |
Erythromycin | 25 | 75 |
Our findings mirror earlier studies in Pakistan and neighboring countries. For example, a 2010 investigation in Karachi found that 92% of their VRE isolates harbored vanA, and none were vanB-positive. That study also noted a single dominant pulsotype spreading across hospitals, suggesting clonal dissemination of vanA-positive enterococci [13]. Similarly, research from Iran reported vanA in 91.5% of VRE isolates, with zero vanB detection [18]. Talebi et al. in Tehran and others have consistently observed the presence of vanA and absence of vanB in clinical VRE [24]. These congruent observations underscore that in South Asia and the Middle East, vanA-type VRE has been the dominant phenotype over the past decades. By contrast, vanB-mediated VRE appears to be infrequent in this region. The absence of vanB in our isolates is reassuring in that vanB can be harder to detect in some labs (due to inducible resistance and variable expression), and its emergence often signals local outbreak strains. In some parts of the world, however, the situation differs — for instance, hospitals in Australia and parts of Europe have documented endemic vanB VRE strains with minimal vanA presence. The predominance of vanB in those settings (e.g., a Melbourne study found many vanB-positive VRE and no vanA) highlights how epidemiology can vary [8, 14, 15, 16, 28]. Our data affirms that Lahore’s tertiary care VRE profile aligns with the broader trend of vanA dominance in Asia.
We did not detect any vanC or vanD genes in the VRE isolates. This was expected: vanC genes (vanC1, C2, C3) are intrinsic to E. gallinarum and E. casseliflavus, which exhibit low-level vancomycin resistance (MIC typically 8–32 μg/mL) [8]. Those species are relatively uncommon pathogens and were not isolated in our clinical samples. vanD is a rarer acquired resistance gene reported in sporadic E. faecium isolates; its absence in our collection is not surprising. The fact that all our VRE were E. faecium or E. faecalis and all carried vanA suggests a somewhat uniform population of resistant strains, possibly related to a single lineage or resistance plasmid circulating in the hospital. In practical terms, this uniformity means that the high-level vancomycin resistance encountered in our patients can be attributed to a single well-known mechanism (VanA type), which has implications for detection and control. For instance, molecular assays (like PCR or GeneXpert) targeting vanA would be highly effective in screening patients or environmental samples in our setting [28].
Another important finding of our study is the predominance of urinary tract sources (85%) among VRE infections [11]. Enterococci are among the leading causes of hospital-acquired urinary tract infections, especially in patients with urinary catheters or urological interventions. Our data specifically indicates that VRE is very commonly isolated from urine, which aligns with international observations. A North American surveillance study (NAVRESS) noted that VRE urinary isolates are common and primarily of the vanA genotype. In that 2002 study, ~84% of urinary VRE isolates carried vanA, very similar to our 100% vanA rate, and it demonstrated that linezolid and nitrofurantoin remained effective options for such UTIs [28]. The high frequency of urinary VRE in our hospital likely reflects both the heavy use of indwelling catheters (which predispose to enterococcal UTIs) and possibly selective pressure from broad-spectrum antibiotic use in catheterized patients. Many of our VRE UTI cases were in older males with chronic catheterization or in postoperative surgical patients, cohorts known to be at risk for colonization by resistant flora. An implication of this finding is that infection control efforts (like VRE screening) might especially target urology wards or catheterized patients. It also suggests that clinicians should be cautious when treating enterococcal UTIs in our setting — empiric therapy with vancomycin would fail for a significant fraction, necessitating alternatives such as linezolid or daptomycin for confirmed VRE UTIs.
The demographic and clinical patterns observed provide further insight into VRE epidemiology. The median age of patients with VRE infection was 58, and fully half were above 60 years old. This strong association with older age is consistent with literature that VRE infections typically occur in older, debilitated patients with co-morbidities. Advanced age often correlates with more frequent healthcare exposure and antibiotic use, which are risk factors for acquiring VRE. We found age > 50 to be significantly associated with VRE isolation (p = 0.01), reinforcing that elderly patients represent a high-risk group. No significant gender predisposition was seen; while slightly more VRE cases were male, this likely reflects hospital demographics or the fact that male patients may have longer hospital stays in certain wards. Generally, prior studies have not identified gender as a major independent risk factor for VRE, and our results concur with that [17, 19, 20].
One of the most pertinent risk factors for VRE identified in our analysis was ICU admission. More than one-third of VRE isolates were from ICU patients, and statistically VRE was significantly overrepresented in ICUs compared to other wards (p = 0.02). The ICU environment is well-known to foster VRE transmission due to factors like high antibiotic selective pressure (e.g., extensive vancomycin and cephalosporin use), vulnerable patient populations (immunosuppressed, with invasive devices), and frequent contact with healthcare workers and surfaces that can mediate cross-transmission. Our hospital’s ICU VRE rate aligns with the concept that ICUs act as “hotspots” for VRE. Infection control interventions, such as strict contact precautions, hand hygiene enforcement, environmental cleaning, and possibly VRE active surveillance cultures, should be concentrated in the ICU setting to curb spread. Indeed, the clonal spread of VRE in hospitals has often been traced to inadequate infection control in ICUs and transfer of colonized patients between units. Recognizing that our VRE are exclusively vanA-positive also means that rapid PCR screening for vanA could be used in the ICU to identify carriers, an approach that has been recommended in outbreak settings [22, 25, 28].
It is worth contextualizing our findings in the larger framework of antimicrobial resistance in Pakistan and globally. The 9.1% prevalence of VRE among enterococcus isolates in our study is considerable, though not as high as some reports from other countries. A recent meta-analysis in India found a pooled VRE prevalence of ~12.4%, and in Egypt the average VRE rate was 26%, indicating substantial variability between regions and hospitals [12]. Our single-center snapshot likely underestimates community prevalence since we focused on clinical samples (patients with infections). Nonetheless, the presence of vanA VRE at nearly 10% frequency in a tertiary hospital is alarming for patient safety, as it narrows treatment options and can lead to worse outcomes. VRE infections (especially bloodstream infections) have been associated with higher mortality and longer hospital stays compared to vancomycin-susceptible infections. The global expansion of VRE over the past two decade, rising from negligible rates in the 1990s to significant proportions now, underscores the need for diligent antimicrobial stewardship. Measures such as restricting unnecessary vancomycin use and employing it only when indicated (to avoid selecting for VRE) are critical. Our hospital should also ensure prudent use of cephalosporins and anti-anaerobe antibiotics, which have been implicated in promoting VRE colonization by wiping out competing flora [26, 27].
The uniform detection of vanA has direct clinical implications. Therapeutically, vanA-mediated resistance confers high MICs to vancomycin (often > 256 µg/mL) and also resistance to teicoplanin, ruling out all glycopeptide antibiotics. This leaves limited options for treating serious VRE infections: linezolid, daptomycin, tigecycline, and newer agents like oritavancin or dalbavancin (which are not yet widely available in our region) [28]. Thankfully, vanA-positive strains remain susceptible to linezolid and daptomycin in most cases; our laboratory data (not detailed in results) indicated 100% susceptibility to linezolid among the VRE isolates. Nitrofurantoin also retained activity in urinary isolates, offering an oral option for UTIs, consistent with reports from North America. However, emerging resistance to even these last-line drugs (e.g., linezolid-resistant VRE with optrA genes) has been documented elsewhere, which would be devastating if it occurred here. Hence, preventing the spread of vanA VRE is paramount to preserving our remaining effective antibiotics.
Limitations
Our study carries several limitations that should be acknowledged. First, it was conducted in a single tertiary care center; therefore, the findings may not be fully generalizable to other hospitals or community settings in Pakistan. VRE prevalence can vary between institutions, and a multicenter approach would better capture the national situation. Second, we did not perform detailed molecular typing (e.g., pulsed-field gel electrophoresis or whole-genome sequencing) of the vanA-positive isolates. Such typing could confirm whether a single clone or plasmid was responsible for the spread, as was seen in Karachi. Nonetheless, the uniform gene type suggests either a common source or horizontally transferred element, which epidemiologically indicates clonal or plasmid dissemination. Third, we focused on the four main van genes (A, B, C, D). It is highly unlikely given our results, but conceivably other rare van genes (like vanE, vanG, vanL, etc.) could be present — though these generally confer low-level resistance or have only been reported in isolated cases. We believe our target panel adequately covered the clinically relevant resistance genes. Another limitation is that we did not capture data on patient outcomes or treatment, so we cannot directly comment on the morbidity or mortality associated with these VRE infections. However, prior studies have shown that VRE bacteremia, for instance, has significantly higher mortality than VSE (vancomycin-susceptible enterococci) bacteremia, underscoring the clinical importance of our findings.
Despite these limitations, our study provides valuable baseline data for Lahore and expands the understanding of VRE in Pakistan. To our knowledge, this is the first report from a Lahore hospital confirming that vanA is the exclusive vancomycin resistance gene in circulating clinical enterococci. This information is crucial for guiding diagnostic and infection control practices. For example, laboratories can confidently use vanA-specific PCR or chromogenic media to screen for VRE, knowing that vanB (which can sometimes yield false negatives in molecular tests) is currently not a factor locally. Infection control teams should be aware that any VRE outbreak is likely to involve vanA-positive E. faecium or E. faecalis, and measures can be tailored accordingly.
Conclusion
In conclusion, the study highlights that vancomycin resistance in enterococci at our tertiary care hospital is uniformly mediated by the vanA gene. The predominance of vanA mirrors regional trends and emphasizes the role of high-level glycopeptide resistance in our healthcare-associated infections. Clinically, this translates to the need for alternative therapies and robust infection control to prevent dissemination. We observed that VRE infections were most common in older patients and in ICU settings and predominantly manifested as urinary tract infections. These findings can help clinicians and policymakers prioritize surveillance (e.g., screening high-risk units or patients) and implement targeted interventions (such as antimicrobial stewardship focusing on vancomycin use). Going forward, continuous monitoring of van gene patterns will be important — should vanB or other genotypes emerge, it could signal a shift in the epidemiology. Additionally, controlling the spread of vanA VRE is critical; interventions like isolation of colonized patients, environmental decontamination, and hand hygiene enforcement are proven strategies. Given the international spread of VRE and the ease of gene transmission via plasmids, a concerted effort is needed to contain vanA both locally and globally. Our hospital has since strengthened its infection control policies, including active surveillance cultures in the ICU, in response to these findings. Ultimately, the goal is to limit the impact of VRE on vulnerable patients while we await new therapeutic options, a goal that aligns with the global call to action against antimicrobial resistance.
Additional information
Conflicts of interest. The authors declare no conflicts of interest.
Funding. This work was supported by the Research Fund of Sheikh Zayd Hospital, Lahore.
Declaration of generative AI and AI-assisted technologies in the writing process. During the preparation of this work the authors used ChatGPT in order to improve the language and readability of the manuscript. After using this tool/service, the authors reviewed and edited the content as needed and take full responsibility for the content of the published article.
About the authors
Aisha Liaqat
Continental Medical College and Hayat Memorial Hospital
Email: aishaliaqat68@gmail.com
ORCID iD: 0009-0001-7866-4064
Department of Microbiology
Pakistan, LahoreMuhammad Imran
Basil Hetzel Institute for Translational Health Research, Central Adelaide Local Health Network; The University of Adelaide
Author for correspondence.
Email: muhammad.imran@adelaide.edu.au
ORCID iD: 0009-0005-6402-1622
PhD, Department of Otolaryngology and Head and Neck Surgery, The Department of Surgery, Faculty of Health and Medical Sciences
Australia, Adelaide; AdelaideRamna Zia
University of Management and Technology
Email: ramnazia1010@gmail.com
ORCID iD: 0000-0002-9655-722X
MS, Department of Life Sciences, School of Science
Pakistan, LahoreBenish Javed
University Institute of Medical Lab Technology, University of Lahore
Email: benishjaved2211@gmail.com
MS, Faculty of Allied Health Sciences
Pakistan, LahoreAdnan Yaseen
Shaikh Zayed Medical Complex
Email: adnan.yaseen97@gmail.com
Department of Microbiology
Pakistan, LahoreChaudhry Ahmed Shabbir
The University of Adelaide
Email: ahmed.chaudhry@adelaide.edu.au
PhD, School of Public Health, North Terrace
Australia, AdelaideReferences
- Acharya Y., Dhanda G., Sarkar P., Haldar J. Pursuit of next-generation glycopeptides: a journey with vancomycin. Chem. Commun., 2022, vol. 58, no. 12, pp. 1881–1897. doi: 10.1039/D1CC06635H
- Adegoke A.A., Madu C.E., Reddy P., Stenström T.A., Okoh A.I. Prevalence of vancomycin resistant Enterococcus in wastewater treatment plants and their recipients for reuse using PCR and MALDI-ToF MS. Front. Environ. Sci., 2022, vol. 9: 797992. doi: 10.3389/fenvs.2021.797992
- Ahmed M.O., Baptiste K.E. Vancomycin-resistant enterococci: a review of antimicrobial resistance mechanisms and perspectives of human and animal health. Microb. Drug Resist., 2018, vol. 24, no. 5, pp. 590–606.
- Arias C.A., Murray B.E. The rise of the Enterococcus: beyond vancomycin resistance. Nat. Rev. Microbiol., 2012, vol. 10, no. 4, pp. 266–278.
- Azzam A., Elkafas H., Khaled H., Ashraf A., Yousef M., Elkashef A.A. Prevalence of vancomycin-resistant enterococci (VRE) in Egypt (2010–2022): a systematic review and meta-analysis. J. Egypt. Public Health Assoc., 2023, vol. 98, no. 1: 8. doi: 10.1186/s42506-023-00133-9
- Bilal H., Khan M.N., Rehman T., Hameed M.F., Yang X. Antibiotic resistance in Pakistan: a systematic review of past decade. BMC Infect. Dis., 2021, vol. 21, no. 1: 244. doi: 10.1186/s12879-021-05906-1
- Cairns K.A., Udy A.A., Peel T.N., Abbott I.J., Dooley M.J., Peleg A.Y. Therapeutics for vancomycin-resistant enterococcal bloodstream infections. Clin. Microbiol. Rev., 2023, vol. 36, no. 2: e00059-22.
- Clark N.C., Teixeira L.M., Facklam R.R., Tenover F.C. Detection and differentiation of vanC-1, vanC-2, and vanC-3 glycopeptide resistance genes in enterococci. J. Clin. Microbiol., 1998, vol. 36, no. 8, pp. 2294–2297. doi: 10.1128/JCM.36.8.2294-2297.1998
- De Oliveira D.M., Forde B.M., Kidd T.J., Harris P.N., Schembri M.A., Beatson S.A., Paterson D.L., Walker M.J. Antimicrobial resistance in ESKAPE pathogens. Clin. Microbiol. Rev., 2020, vol. 33, no. 3: e00181-19.
- Doss Susai Backiam A., Duraisamy S., Karuppaiya P., Balakrishnan S., Chandrasekaran B., Kumarasamy A., Raju A. Antibiotic susceptibility patterns and virulence-associated factors of vancomycin-resistant enterococcal isolates from tertiary care hospitals. Antibiotics (Basel), 2023, vol. 12, no. 6: 981.
- Dubin K., Pamer E.G. Enterococci and their interactions with the intestinal microbiome. Microbiol. Spectr., 2014, vol. 5: BAD-0014-2016. doi: 10.1128/microbiolspec.BAD-0014-2016
- Eichel V.M., Last K., Brühwasser C., von Baum H., Dettenkofer M., Götting T., Grundmann H., Güldenhöven H., Liese J., Martin M., Papan C. Epidemiology and outcomes of vancomycin-resistant enterococcus infections: a systematic review and meta-analysis. J. Hosp. Infect., 2023, vol. 141, pp. 119–128. doi: 10.1016/j.jhin.2023.09.008
- Fasih N., Zafar A., Khan E., Jabeen K., Hasan R. Clonal dissemination of vanA positive Enterococcus species in tertiary care hospitals in Karachi, Pakistan. J. Pak. Med. Assoc., 2010, vol. 60, no. 10, pp. 805–809.
- Freedberg D.E., Zhou M.J., Cohen M.E., Annavajhala M.K., Khan S., Moscoso D.I., Brooks C., Whittier S., Chong D.H., Uhlemann A.-C. Pathogen colonization of the gastrointestinal microbiome at intensive care unit admission and risk for subsequent death or infection. Intensive Care Med., 2018, vol. 44, pp. 1203–1211.
- Iqbal F., Alocious A., Joy S.C., Anburaj S.E., Rajesh V., Unnikrishnan M., Steinke D., Chandra P. Vancomycin-resistant enterococci: a rising challenge to global health. Clin. Epidemiol. Glob. Health, 2024: 101663.
- Karki S., Houston L., Land G., Ballard S.A., Johnson P., Grabsch E., Richards M., Cheng A.C. Prevalence and risk factors for VRE colonisation in a tertiary hospital in Melbourne, Australia: a cross-sectional study. Antimicrob. Resist. Infect. Control, 2012, vol. 1: 31. doi: 10.1186/2047-2994-1-31
- Kibwana U.O., Manyahi J., Moyo S.J., Blomberg B., Roberts A.P., Langeland N., Mshana S.E. Antimicrobial resistance profile of Enterococcus species and molecular characterization of vancomycin-resistant Enterococcus faecium from fecal samples of newly diagnosed adult HIV patients in Dar es Salaam, Tanzania. Front. Trop. Dis., 2024, vol. 5: 1307379.
- Moosavian M., Ghadri H., Samli Z. Molecular detection of vanA and vanB genes among vancomycin-resistant enterococci in ICU-hospitalized patients in Ahvaz in southwest Iran. Infect. Drug Resist., 2018, vol. 11, pp. 2269–2275. doi: 10.2147/IDR.S177886
- Nasir S.A.R., Zeeshan M., Ghanchi N., Saeed N., Ghayas H., Zaka S., Ashraf J., Jabeen K., Farooqi J., Hasan Z. Linezolid-resistant Enterococcus faecium clinical isolates from Pakistan: a genomic analysis. BMC Microbiol., 2024, vol. 24, no. 1: 347.
- Nikmanesh B., Yazdansetad S., Konkori M., Sadredinamin M., Ghalavand Z., Nojookambari N.Y. Prevalence and resistance profiles of pediatric enterococcal isolates: a five-year update from Children’s Medical Center Hospital, Tehran. Can. J. Infect. Dis. Med. Microbiol., 2024, vol. 2024, no. 1: 5529598.
- Orababa O.Q., Soriwei J.D., Akinsuyi S.O., Essiet U.U., Solesi O.M. A systematic review and meta-analysis on the prevalence of vancomycin-resistant enterococci (VRE) among Nigerians. Porto Biomed. J., 2021, vol. 6, no. 1: e125. doi: 10.1097/j.pbj.0000000000000125
- Philip A., Oueslati S., Villa F., Pannetier C., Cattoir V., Duranteau J., Figueiredo S., Naas T. Development of an ultrafast PCR to detect clinically relevant acquired vancomycin-resistance genes from cultured enterococci. J. Antimicrob. Chemother., 2024, vol. 79, no. 5, pp. 997–1005.
- Smout E., Palanisamy N., Valappil S.P. Prevalence of vancomycin-resistant Enterococci in India between 2000 and 2022: a systematic review and meta-analysis. Antimicrob. Resist. Infect. Control, 2023, vol. 12: 79. doi: 10.1186/s13756-023-01287-z
- Talebi M., Eshraghi S.S., Pourshafie M.R., Pourmand M.R., Eshraghian M.R. Characterization of vancomycin-resistant Enterococcus faecium. Iran. J. Public Health, 2007, vol. 36, no. 4, pp. 20–25.
- Wayne P. Clinical and Laboratory Standards Institute: Performance Standards for Antimicrobial Susceptibility Testing. Wayne: CLSI, 2011.
- Yan M.-Y., He Y.-H., Ruan G.-J., Xue F., Zheng B., Lv Y. The prevalence and molecular epidemiology of vancomycin-resistant Enterococcus (VRE) carriage in patients admitted to intensive care units in Beijing, China. J. Microbiol. Immunol. Infect., 2023, vol. 56, no. 2, pp. 351–357.
- Yoo I.Y., Kwon J.A., Lee M., Jung S.H., Kim J.O., Ha S.I., Park Y.J. Prevalence and molecular characterization of vancomycin-variable Enterococcus faecium isolated from clinical specimens. Ann. Lab. Med., 2024, vol. 44, no. 5, pp. 450–454. doi: 10.3343/alm.2023.0430
- Zhanel G.G., Laing N.M., Nichol K.A., Palatnick L.P., Noreddin A., Hisanaga T., Johnson J.L., Hoban D.J., NAVRESS Group. Antibiotic activity against urinary tract infection (UTI) isolates of vancomycin-resistant enterococci (VRE): results from the 2002 North American Vancomycin Resistant Enterococci Susceptibility Study (NAVRESS). J. Antimicrob. Chemother., 2003, vol. 52, no. 3, pp. 382–388. doi: 10.1093/jac/dkg352
- Zhou W., Zhou H., Sun Y., Gao S., Zhang Y., Cao X., Zhang Z., Shen H., Zhang C. Characterization of clinical enterococci isolates, focusing on vancomycin-resistant enterococci in a tertiary hospital in China: based on data from 2013–2018. BMC Infect. Dis., 2020, vol. 20, pp. 1–9.
Supplementary files



