Heterogeneity of virulence factors among Porphyromonas gingivalis clinical isolates from patients with chronic generalized periodontitis
- Authors: Koroleva I.V.1,2, Mikhailova E.S.1, Privalova K.A.3, Ermolaeva L.A.1, Tumanova S.A.1, Suvorov A.N.1,2
-
Affiliations:
- St. Petersburg State University
- Institute of Experimental Medicine
- Pavlov First St. Petersburg State Medical University
- Issue: Vol 14, No 6 (2024)
- Pages: 1079-1086
- Section: ORIGINAL ARTICLES
- Submitted: 26.09.2024
- Accepted: 23.10.2024
- Published: 25.12.2024
- URL: https://iimmun.ru/iimm/article/view/17783
- DOI: https://doi.org/10.15789/2220-7619-HOV-17783
- ID: 17783
Cite item
Full Text
Abstract
The development of chronic generalized periodontitis occurs due to a combination of a several causes, among which the leading role is assigned to periodontal pathogens, which include P. gingivalis. Among P. gingivalis virulence factors, the polysaccharide capsule, fimbria proteins, cysteine proteases, and hemagglutinins are of special importance. The study was aimed to investigate the prevalence of specific virulence genes and identify a virulent genotype among P. gingivalis isolates found in patients with severe chronic generalized periodontitis (CGP). 41 patients (27 women and 14 men, average age 43.9±1.5 years) were examined, of which main and control group consisted of 22 patients with severe CGP and 19 patients without inflammatory periodontal diseases, respectively. The PCR data allow to consider type II fimbria (FimA II), arginine-dependent type A protease (RghA) and lysine-dependent protease (Kgh) as specific markers for the detection of more virulent P. gingivalis strains. It was found that in St. Petersburg, the following P. gingivalis genotypes predominate among patients with severe CGP: fimA II:kg:rghA, fimA II:kgh and fimA II:rghA. In addition, it has been demonstrated that virulent genotypes are detected to a small extent in P. gingivalis isolates from healthy control group patients. The identification of P. gingivalis strains with a more prominent pathogenic potential and the detection of their virulent genotypes is of great practical importance, in the future allowing to develop advanced effective methods for disease prevention to be used in a personalized medicine strategy. The results obtained are also of high importance due to the recorded variability in the circulation of P. gingivalis strain genotypes in various worldwide regions.
Full Text
Introduction
Damaging effect of dental plaque plays a leading role in the development of inflammatory periodontal diseases. The today’s science views dental plaque as a biofilm consisting of a structured bacterial community and their metabolic products [1, 17]. During the formation of dental plaque, the composition of microbiota takes a trend to change from the dominance of aerobic and facultative anaerobic forms to obligate anaerobic gram-negative rods and spiral-shaped bacteria [2, 15].
According to the “keystone pathogen hypothesis” theory P. gingivalis is considered to be a key periodontal pathogen [9, 10]. Well described the ability of P. gingivalis to have an impact on the innate immune system of the host organism resulting in dysbiotic changes in the composition of microbiota and, therefore, in an inflammatory response of periodontal tissues [11, 20]. Thus, P. gingivalis is rightfully considered a “keystone pathogen” agent and, even at low concentrations, it is capable of causing chronic periodontitis [9, 10, 12, 21]. Since P. gingivalis belongs to obligate anaerobes, the main habitat of this periodontal pathogen is the periodontal pocket. P. gingivalis is a secondary plaque colonizer and often forms colonies with S. gordonii and P. intermedia [12]. In addition, as Socransky “ecological theory” states, P. gingivalis forms a complex with T. denticola and T. forsythia [8]. This combination of microorganisms is detected in the most severe stages of chronic periodontitis. This “red complex” aggressively affects bone tissue and gum mucosa, forming deep periodontal pockets and causing severe destruction of jaw bone tissue [24, 28].
In recent years, it has become obvious that in the case of inflammatory periodontal diseases, there are factors that enhance some mechanisms of disease development making its course more severe. Differences in the course and disease development rate are due to the diversity of the composition and degree of periodontopathogen strains virulence [5, 23]. Scientists’ views about the influence of genetic diversity of P. gingivalis strains on the development and course of inflammatory periodontal diseases are contradictory. It is believed that P. gingivalis strains differ in the degree of virulence in patients with different periodontitis currents, affecting the clinical course of the disease. Experimental and clinical studies have revealed differences in the pathogenic potential of P. gingivalis strains, dividing them into “invasive” and “non-invasive” strains [7, 21, 22]. On the other hand, there is an idea that the course of periodontitis is determined not by the diversity of strains of periodontal pathogens, but by the individual characteristics of the host organism reactivity [7]. Moreover, a number of studies have shown the availability of identical strains of P. gingivalis in patients with intact periodontium and with inflammatory periodontal diseases [26].
P. gingivalis is known to express many virulence factors: fimbriae, lipopolysaccharides, arginine- and lysine-dependent proteases, hemagglutinins and capsular polysaccharide, which genes are very diverse [3, 16, 27]. Fimbriae of P. gingivalis are classified into six genotypes — I, Ib, II, III, IV, V, that was demonstrated by a variation in the nucleotide sequence of the fimA gene encoding FimA (fimbryonic subunits) [6]. P. gingivalis with type I fimbriae has been shown to be associated with patients without inflammatory periodontal diseases [4]. On the other hand, there is an evidence that fimbriae of P. gingivalis with genotype II have greater adhesive ability and, therefore, greater virulence compared to other genotypes [6]. Pathogenic heterogeneity of P. gingivalis strains with type II fimbriae has been demonstrated, that determines the proteolytic and invasive activity of this periodontopathogen [14]. At the same time, it is believed that there are no significant differences between P. gingivalis strains with different genotypes of fimbriae regarding virulence [26].
The issue of genetic heterogeneity of P. gingivalis and its virulence factors is being actively studied, and the scientific views about the role of those factors in the formation of a virulent genotype are contradictory. Therefore, the further need to examine the genetic heterogeneity of P. gingivalis in patients with inflammatory periodontal diseases makes this research relevant. To study genetic heterogeneity of fimbriae and cysteine proteases of P. gingivalis strains in patients with chronic generalized periodontitis, as well as deriving characteristics of the virulent genotype of P. gingivalis is very perspective. In addition, it is of interest to examine the prevalence of the virulent genotype among P. gingivalis strains isolated from patients without inflammatory periodontal diseases.
The purpose of the research: to study the prevalence of specific virulence genes and identify the virulent genotype among P. gingivalis strains detected in patients with severe chronic generalized periodontitis.
Materials and methods
A research was conducted on 41 patients (27 women and 14 men) aged 36 to 50 years (average age was 43.9±1.5 years). The patients were divided into two groups. The first group included 22 patients with severe chronic generalized periodontitis (CGPS). The control group consisted of 19 patients without inflammatory periodontal diseases (IPD). To form a control group, 69 patients without IPD were preliminarily examined and those patients in whom P. gingivalis was identified were selected.
In the course of research, a clinical examination of patients was performed, including collection of anamnesis, complaints, assessment of dental status, index assessment of the periodontal tissue condition (OHI-S index, Green, Vermillion, 1964; Silness-Loe index, Silness, Loe, 1964; CPITN index, WHO, 1978, Ainamo et al., 1982; PMA index, Parma S., 1960; BOP index, Ainamo, Bau, 1975), as well as microbiological examination of material from the periodontal sulcus or periodontal pockets of the examined patients using PCR diagnostics. X-ray examination included assessment of data obtained from GALILEOS cone-beam computed tomography (Sirona, Germany).
Material was collected from periodontal pockets in patients with CGPS (main group) and from the periodontal sulcus in healthy patients (control group) using sterile paper absorbents Absorbent Paper Points from Euronda, size No. 25. Paper absorbents were placed in the gingival sulcus or periodontal pockets for 7–10 seconds, after which they were immediately transferred into sterile sealed Eppendorf tubes and stored at –50°C. A special cooling device was used to transport the material to maintain storage conditions.
To isolate DNA, we used the Express-DNA-Bio kit in accordance with the instructions. The resulting DNA samples were stored at –20°C until polymerase chain reaction (PCR) was performed.
Primer 3 and OLIGO 4.0 computer programs was used to perform the design, analysis of oligonucleotide primers and identification of the primer melting temperature (Table 1). Primers to identify fimA I and IV genes were used from the publication of Takashi Yoshino et al. [25].
Table 1. Oligonucleotide primers
Name | 5’ → 3’ | Т0ann. | DNA fragments size (bp) | |
1 | Gin1 | GTATATGCTCGACGAGGTGGAA | 57.0 | 334 |
2 | Gin2 | ATTGTCCAGGGTAACTTCTTCG | ||
3 | Fim II1 | TGTTGCAGACAATAATCCTAC | 51.0 | 250 |
4 | Fim II2 | CGATTACCAAGTAGCATTCTGA | ||
5 | Kgp1 | TCCACTTCTGACCACATCTCAA | 56.0 | 397 |
6 | Kgp2 | AGCTTCCCGATAGTAATGAGCA | ||
7 | RgpA1 | AATCCCGGAACAACAACACTTT | 56.0 | 331 |
8 | RgpA2 | TGAAGTTGGATGCATCGTTACC |
The data obtained in the course of the research were processed on a personal computer using the software system “Statistica for Windows” (v. 7.0). To visualize the results of the study, diagrams were constructed in Microsoft Excel.
Results
All patients of the main group complained of bleeding gums during brushing, tooth mobility, swelling and inflammation of the gums (Fig. 1). In 59.1% cases, patients in the main group complained of food getting between the teeth, as well as halitosis. Patients with CGPS in 72.73% cases marked the displacement of teeth resulting from a functional secondary traumatic occlusion and in 68.18% cases — itching and gum area burning caused by the inflammatory edema of periodontal tissue. 2 patients in the control group had complaints only about food getting between the teeth owing to lack of a contact point in the area of several tooth pairs in the maxilla and mandible.
Figure 1. Complaints from patients in the main and control groups
Hyperemia of the marginal and attached gums, and exudation from periodontal pockets has been revealed in all patients of the main group. Gingival recession has been found in all patients with CGPS, the average value amounted to 1.96±0.07 mm. Lesions of the furcation in the area of the molars of the maxilla and mandible were detected in 15 patients (68.2% of cases). Tooth mobility has been revealed in all patients of the main group, most often grade 1–2.
The values of the OHI-S hygiene index in patients with CGPS in the main group were 4.77±0.12, in the control group — 0.44±0.04 (Fig. 2).
Figure 2. OHI-S, CPITN, Silness-Loe, PMA (%) и BOP (%) index rates in patients of the main and control groups
The obtained values of the OHI-S index indicate poor oral hygiene in patients of the main group that is typical for patients with CGPS who lack the correct skills to practice individual oral hygiene. Statistically significant differences have been found in the Silness-Loe index between patients of the main and control groups indicating a cause-and-effect correlation between the mineralized supra- and subgingival dental plaque and inflammation in the periodontal tissues (p < 0.001).
The PMA index and BOP bleeding index rates in patients of the main group indicate inflammatory phenomena in periodontal tissues. A distinct inflammatory-destructive process in periodontal tissues in patients of the main group was confirmed by the rates of the periodontal index. The rates of the CPITN index in patients with CGPS of the main group reached 3.97±0.23. High rates of the CPITN index for patients in the main group indicate the need for complex treatment, including surgical treatment of periodontal diseases.
The results obtained during cone-beam computed tomography in patients of the main group correspond to the clinical picture and the diagnosis of CGPS. In all patients of the main group, destruction of the compact lamina of the alveolar bone was revealed along its entire length, and bone pockets were identified in the area of 15.2±3.7 teeth. The amount of bone tissue destruction “more than 1/2 the length of the root” was identified in all patients with CGPS.
The contents of the periodontal pockets in patients of the main group and the subgingival sulcus in patients in the control group have been examined to reveal P. gingivalis using PCR screening (Fig. 3).
Figure 3. Frequency of P. gingivalis occurrence in periodontal pockets/gingival sulcus in patients of the main and control groups
In the main group, the periodontopathogen P. gingivalis has been detected in all patients (100% cases). To form a control group, 69 patients without inflammatory periodontal diseases (inflammatory periodontal diseases) were previously examined, among whom P. gingivalis was detected in 21 patients (30.4% of cases).
22 P. gingivalis isolates of the main group and 19 isolates of the control group were examined by PCR to reveal genes encoding fimbriae types I, II, and IV (Fig. 4).
Figure 4. Prevalence of fimbriae types I, II and IV genes (fimA I, fimA II and fimA IV) among P. gingivalis isolates in patients of the main and control groups
The results indicate the predominance of the fimA II genotype (40.9% of cases) among the P. gingivalis isolates of the main group. The fimA I genotype is detected quite often as well, in 22.7% cases, while the prevalence of the fimA IV genotype was insignificant (9.1% of cases). Thus, among P. gingivalis isolates from patients with CGPS, strains carrying fimbriae of types I and II predominantly circulate. Among the 19 P. gingivalis isolates of the control group, fimA II also dominates (31.6% cases), the prevalence of which is only by 22.7% lower compared to the prevalence rate of fimA II in the main group. The fimA I genotype in P. gingivalis isolates of the control group is found quite rarely (5.3% of cases), and the fimA IV genotype is not available at all.
The gene (kgh), encoding a lysine-dependent protease, in P. gingivalis isolates of the main group is detected in 68.2% cases, while the gene (rghA), encoding an arginine-dependent protease type A, is detected in P. gingivalis isolates of all patients (100% cases) (Fig. 5).
Figure 5. Prevalence of lysine-dependent protease (kgh) and arginine-dependent protease type A (rghA) genes among P. gingivalis isolates in patients of the main and control groups
When comparing the corresponding genes in control group P. gingivalis isolates, a significant reduction in the prevalence of kgh and rghA was revealed, to 26.3% and 47.4% cases, respectively.
Table 2 shows the prevalence of various genotypes of the studied virulence factors among P. gingivalis isolates of the main and control groups.
Table 2. Distribution of fimbria types I, II and IV (fimA I, II, IV), lysine-dependent protease (kgh) and arginine-dependent protease type A (rghA) genotypes
Genotypes | Prevalence (%) | |
Main group | Control group | |
fimA I:kgh:rghA | 18.2 | 5.3 |
fimA II:kgh:rghA | 27.3 | 5.3 |
fimA IV:kgh:rghA | 9.1 | 0 |
fimA I:kgh | 18.2 | 5.3 |
fimA I:rghA | 22.7 | 5.3 |
fimA II:kgh | 27.3 | 5.3 |
fimA II: rghA | 40.1 | 18.2 |
fimA IV:kgh | 9.1 | 0 |
fimA IV:rghA | 9.1 | 0 |
When considering three virulence factors, P. gingivalis isolates with genotype fimA II:kgh:rghA (27.3% cases) and fimA I:kgh:rghA (18.2% cases) dominate the main group. Both of those genotypes are present in almost half (45.5% cases) of P. gingivalis isolates of the main group that suggests a significant contribution of P. gingivalis with those genotypes in the development of chronic generalized periodontitis. In P. gingivalis isolates of the control group, genotypes fimA II:kgh:rghA and fimA I:kgh:rghA are found quite rare, in 5.3% cases. When considering different genotypes from two virulence factors in P. gingivalis isolates of the control group, genotypes fimA II:rghA (40.1% cases), fimA II:kgh (27.3% cases) and fimA I:rghA (22.7% cases) predominate. In P. gingivalis isolates from the control group, the fimA II:rghA genotype also predominate (18.2% cases). The remaining genotypes listed above are found rare in P. gingivalis isolates from the control group, in 5.3% cases.
Discussion
Among the virulence factors of P. gingivalis, the polysaccharide capsule, fimbriae proteins, arginine- and lysine-dependent proteases, and hemagglutinins are particularly distinguished. In the work in question, the heterogeneity of genes encoding fimbriae types I, II and IV and arginine- and lysine-dependent proteases was studied in clinical isolates of P. gingivalis obtained from healthy patients and patients with CGPS. It has previously been demonstrated that P. gingivalis is isolated from healthy patients in 10–25% cases [13]. A higher percentage of P. gingivalis detection was reported in the dental plaque of healthy Japanese patients, up to 36.8% cases [4]. A study of samples obtained from the subgingival sulcus of 69 healthy patients in St. Petersburg demonstrates a high percentage of carriage of P. gingivalis, up to 30.4% cases. The prevalence of P. gingivalis in patients of the main group amounted to 100% cases that fully correlates with previous studies [13, 18]. Among P. gingivalis fimbriae, six genotypes of fimA have been described, of which genotypes II and IV have been characterized as the most common ones among P. gingivalis isolates received from patients with IPD (inflammatory periodontal disease) in Sweden and Japan [4, 25]. The remaining genotypes of fimbriae were detected quite rarely [25]. In agreement with previous studies, among the three types of arginine-dependent proteases, type A arginine-dependent protease (RghA) was found to be dominant. Among lysine-dependent Kgh proteases, both genotypes I and II occurred with approximately the same frequency [25].
When studying the prevalence of virulence factors in the main group, it has been demonstrated that genes encoding type II fimbriae (40.9% cases) and type A arginine-dependent protease (100% cases) were present in the first place by frequency of occurrence. The obtained data suggest a direct correlation between CGPS and P. gingivalis isolates carrying the rghA gene (r = 1.0). The lysine-dependent protease gene kgh is detected in 68.2% of cases. In P. gingivalis isolates from healthy patients, type II fimbriae and type A arginine-dependent protease were present in 31.6% and 47.4% of cases, respectively. Lysine-dependent protease Kgh is detected in 26.3% of cases. The presented results suggest that P. gingivalis strains producing fimbriae FimA II, as well as Kgh and RghA, have a more pronounced pathogenic potential. Thus, one can consider those virulence factors as markers for detecting more pathogenic strains of P. gingivalis.
Comparing data on the prevalence of P. gingivalis virulence factors in the St. Petersburg with previously published data for Sweden, it’s safe to say that type II fimbriae are most often found in P. gingivalis isolates from patients with IPD. However, it is worth noting that P. gingivalis isolates with type II fimbriae are recorded more often in Swedish patients (71% cases) compared to patients from St. Petersburg (40.9% cases). Differences in P. gingivalis isolates from St. Petersburg are also revealed when identifying type I and IV fimbriae. In P. gingivalis isolates from Swedish patients, the second most common finding was P. gingivalis with type IV fimbriae (16.1% cases). In the St. Petersburg, P. gingivalis with type IV fimbriae from patients with IPD are rarely found (9.1% cases); moreover, P. gingivalis isolates with type IV fimbriae from healthy patients are not recorded at all. On the other hand, in St. Petersburg, isolates of P. gingivalis with type I fimbriae are more often detected from patients with IPD, in 22.7% cases. The relatively frequent detection of P. gingivalis isolates with type I fimbriae (19.6% cases) from Brazilian patients with IPD has been previously published [19]. In comparison, type I fimbriae was rarely detected in P. gingivalis isolates from Swedish patients (4.8% of cases). In addition, all P. gingivalis isolates from St. Petersburg patients with IPD carry the gene for arginine-dependent protease type A, while in P. gingivalis isolates from Swedish patients with IPD the gene for the mentioned protease is found less frequently, in 75.8% cases. In summary, a study of clinical isolates of P. gingivalis from patients with IPD demonstrates significant regional differences in the prevalence of individual P. gingivalis virulence factors. The findings highlight the significance of such studies for specific regions.
When analyzing genotypic variants for the studied virulence factors of P. gingivalis in the main group, fimA II:kgh:rghA (27.3% cases), fimA II:kgh (27.3%) and fimA II:rghA (40.1% cases) are most common. Those results allow taking into consideration the above-mentioned gene combinations as virulent genotypes of P. gingivalis. It is important to mention that virulent genotypes were found in P. gingivalis isolates from healthy control patients (fimA II:kgh:rghA and fimA II:kgh — in 5.3% cases; fimA II:rghA — in 18.2% cases).
Identification of P. gingivalis strains with more distinct pathogenic potential and detection of their virulent genotypes is of great practical importance. Using obtained clinical and microbiological data, an in-depth research of the etiology of IPD, development and implementation of up-to-date efficient methods to prevent the disease are possible. In addition, the detection of virulent genotype strains among control group patients allows predicting that some healthy patients have an increased susceptibility to developing periodontitis. Keeping that knowledge in mind the dentist will be able to prevent inflammatory periodontal diseases in advance, develop individual oral hygiene for the patient and give appropriate recommendations.
Acknowledgements
The authors express their gratitude to the staff of the Institute of Experimental Medicine for the opportunity to perform this scientific research.
About the authors
I. V. Koroleva
St. Petersburg State University; Institute of Experimental Medicine
Email: e.michailova@spbu.ru
PhD (Biology), Associate Professor, Department of Fundamental Problems of Medicine and Medical Technologies; Senior Researcher, Department of Molecular Microbiology
Russian Federation, St. Petersburg; St. PetersburgEkaterina S. Mikhailova
St. Petersburg State University
Author for correspondence.
Email: e.michailova@spbu.ru
DSc (Medicine), Associate Professor, Associate Professor of the Department of Therapeutic Dentistry
Russian Federation, St. PetersburgK. A. Privalova
Pavlov First St. Petersburg State Medical University
Email: e.michailova@spbu.ru
Resident of the Department of Oral and Maxillofacial Surgery and Surgical Dentistry
Russian Federation, St. PetersburgL. A. Ermolaeva
St. Petersburg State University
Email: e.michailova@spbu.ru
DSc (Medicine), Professor, Head of the Therapeutic Dentistry Department
Russian Federation, St. PetersburgS. A. Tumanova
St. Petersburg State University
Email: e.michailova@spbu.ru
PhD (Medicine), Associate Professor, Associate Professor of the Department of Therapeutic Dentistry
Russian Federation, St. PetersburgA. N. Suvorov
St. Petersburg State University; Institute of Experimental Medicine
Email: e.michailova@spbu.ru
RAS Corresponding Member, DSc (Medicine), Professor, Head of the Fundamental Problems of Medicine and Medical Technologies Department; Head of the Molecular Microbiology Department
Russian Federation, St. Petersburg; St. PetersburgReferences
- Фукс Е.И., Карева Ю.А., Гализина О.А., Таболина Е.С. Современные аспекты этиологии и патогенеза заболеваний пародонта // Российский медико-биологический вестник им. академика И.П. Павлова. 2013. № 3. С. 153–159. [Fuchs E.I., Kareva Yu.A., Galizina O.A., Tabolina E.S. Modern aspects of the etiology and pathogenesis of periodontal diseases. Rossiiskii mediko-biologicheskii vestnik imeni akademika I.P. Pavlova = I.P. Pavlov Russian Medical Biological Herald, 2013, no. 3, pp. 15–39. (In Russ.)]
- Царев В.Н., Николаева Е.Н., Ипполитов Е.В. Пародонтопатогенные бактерии — основной фактор возникновения и развития пародонтита // Журнал микробиологии, эпидемиологии и иммунобиологии. 2017. № 5. С. 101–112. [Tsarev V.N., Nikolaeva E.N., Ippolitov E.V. Periodontopathogenic bacteria — the main factor in the occurrence and development of periodontitis. Zhurnal mikrobiologii, epidemiologii i immunobiologii = Journal of Microbiology, Epidemiology and Immunobiology, 2017, no. 5, pp. 101–112. (In Russ.)] doi: 10.36233/0372-9311-2017-5-101-112
- Ally N., Whisstock J.C., Sieprawska-Lupa M., Potempa J., Le Bonniec B.F., Travis J., Pike R.N. Characterization of the specificity of arginine-specific gingipains from Porphyromonas gingivalis reveals active site differences between different forms of the enzymes. Biochemistry, 2003, vol. 42, no. 40, pp. 11693–11700. doi: 10.1021/bi0349726
- Amano A., Kuboniwa M., Nakagawa I., Akiyama S., Morisaki I., Hamada S. Prevalence of specific genotypes of Porphyromonas gingivalis fimA and periodontal health status. J. Dent. Res., 2000, vol. 79, no. 9, pp. 1664–1668. doi: 10.1177/00220345000790090501
- Bostanci N., Belibasakis G.N. Porphyromonas gingivalis: an invasive and evasive opportunistic oral pathogen. FEMS Microbiol. Lett., 2012, vol. 333, no. 1, pp. 1–9. doi: 10.1111/j.1574-6968.2012.02579.x
- Enersen M., Nakano K., Amano A. Porphyromonas gingivalis fimbriae. J. Oral. Microbiol., 2013, vol. 5. doi: 10.3402/jom.v5i0.20265
- Evans R.T., Klausen B., Ramamurthy N.S., Golub L.M., Sfintescu C., Genco R.J. Periodontopathic potential of two strains of Porphyromonas gingivalis in gnotobiotic rats. Arch. Oral. Biol., 1992, vol. 37, no. 10, pp. 813–819. doi: 10.1016/0003-9969(92)90115-o
- Haffajee A.D., Socransky S.S., Patel M.R., Song X. Microbial complexes in supragingival plaque. Oral. Microbiol. Immunol., 2008, vol. 23, no. 3, pp. 196–205. doi: 10.1111/j.1399-302X.2007.00411.x
- Hajishengallis G., Darveau R.P., Curtis M.A. The keystone-pathogen hypothesis. Nat. Rev. Microbiol., 2012, vol. 10, no. 10, pp. 717–725. doi: 10.1038/nrmicro2873
- Hajishengallis G., Lamont R.J. Beyond the red complex and into more complexity: the polymicrobial synergy and dysbiosis (PSD) model of periodontal disease etiology. Mol. Oral Microbiol., 2012, vol. 27, no. 6, pp. 409–419. doi: 10.1111/j.2041-1014.2012.00663.x
- Hajishengallis G., Diaz P.I. Porphyromonas gingivalis: Immune subversion activities and role in periodontal dysbiosis. Curr. Oral Health. Rep., 2020, vol. 7, no. 1, pp. 12–21. doi: 10.1007/s40496-020-00249-3
- How K.Y., Song K.P., Chan K.G. Porphyromonas gingivalis: an overview of periodontopathic pathogen below the gum line. Front. Microbiol., 2016, vol. 7: 53. doi: 10.3389/fmicb.2016.00053
- Igboin C.O., Griffen A.L., Leys E.J. Porphyromonas gingivalis strain diversity. J. Clin. Microbiol., 2009, vol. 47, no. 10, pp. 3073–3081. doi: 10.1128/JCM.00569-09
- Inaba H., Nakano K., Kato T., Nomura R., Kawai S., Kuboniwa M., Ishihara K., Ooshima T., Amano A. Heterogenic virulence and related factors among clinical isolates of Porphyromonas gingivalis with type II fimbriae. Oral. Microbiol. Immunol., 2008, vol. 23, no. 1, pp. 29–35. doi: 10.1111/j.1399-302X.2007.00386.x
- Kuboniwa M., Lamont R.J. Subgingival biofilm formation. Periodontol. 2000, 2010, vol. 52, no. 1, pp. 38–52. doi: 10.1111/j.1600-0757.2009.00311.x
- Laine M.L., van Winkelhoff A.J. Virulence of six capsular serotypes of Porphyromonas gingivalis in a mouse model. Oral. Microbiol. Immunol., 1998, vol. 13, no. 5, pp. 322–532. doi: 10.1111/j.1399-302x.1998.tb00714.x
- Marsh F.D. Dental plaque as a biofilm and a microbial community — implications for health and disease. BMC Oral Health., 2006, vol. 6 (suppl. 1), p. S14. doi: 10.1186/1472-6831-6-S1-S14
- Mikhaylova E.S., Lashchenov P.V., Koroleva I.V. Clinical and microbiological assessment of periodontal tissues in patients with type 2 diabetes mellitus. J. Intern. Pharm. Research., 2019, vol. 11, no. 4, pp. 831–840.
- Missailidis C.G., Umeda J.E., Ota-Tsuzuki C., Anzai D., Mayer M.P. Distribution of fimA genotypes of Porphyromonas gingivalis in subjects with various periodontal conditions. Oral Microbiol. Immunol., 2004, vol. 19, pp. 224–229. doi: 10.1111/j.1399-302X.2004.00140.x
- Mysak J., Podzimek S., Sommerova P., Lyuya-Mi. Y., Bartova J., Janatova T., Prochazkova J., Duskova J. Porphyromonas gingivalis: major periodontopathic pathogen overview. J. Immunol. Res., 2014, vol. 2014: 476068. doi: 10.1155/2014/476068
- Olsen I., Lambris J.D., Hajishengallis G. Porphyromonas gingivalis disturbs host-commensal homeostasis by changing complement function. J. Oral Microbiol., 2017, vol. 9, no. 1: 1340085. doi: 10.1080/20002297.2017.1340085
- Ozmeriç N., Preus N.R., Olsen I. Genetic diversity of Porphyromonas gingivalis and its possible importance to pathogenicity. Acta Odontol. Scand., 2000, vol. 58, no. 4, pp. 83–87. doi: 10.1080/000163500429190
- Rodrigues R.S., Silveira V.R., Rego R.O. Analysis of Porphyromonas gingivalis fimA genotypes in severe periodontitis patients. Braz. Oral Res., 2020, vol. 34: e090. doi: 10.1590/1807-3107bor-2020.vol34.0090
- Socransky S.S., Haffajee A.D., Cugini M.A., Smith C., Kent R.L.Jr. Microbial complexes in subgingival plaque. J. Clin. Periodontol., 1998, vol. 25, no. 2, pp. 134–144. doi: 10.1111/j.1600-051x.1998.tb02419.x
- Yoshino T., Laine M.L., van Winkelhoff A.J., Dahl G.Genotype variation and capsular serotypes of Porphyromonas gingivalis from chronic periodontitis and periodontal abscesses. FEMS Microbiol. Lett., 2007, vol. 270, no. 1, pp. 75–81. doi: 10.1111/j.1574 6968.2007.00651.x
- Umeda J.E., Missailidis C., Longo P.L., Anzai D., Wikström M., Mayer M.P. Adhesion and invasion to epithelial cells by fimA genotypes of Porphyromonas gingivalis. Oral Microbiol. Immunol., 2006, vol. 21, no. 6, pp. 415–419. doi: 10.1111/j.1399-302X.2006.00312.x
- Wang P.L., Ohura K. Porphyromonas gingivalis lipopolysaccharide signaling in gingival fibroblasts-CD14 and Toll-like receptors. Crit. Rev. Oral Biol. Med., 2002, vol. 13, no. 2, pp. 132–142. doi: 10.1177/154411130201300204
- Xu W., Zhou W., Wang H., Liang S. Roles of Porphyromonas gingivalis and its virulence factors in periodontitis. Adv. Protein. Chem. Struct. Biol., 2020, vol. 120, pp. 45–84. doi: 10.1016/bs.apcsb.2019.12.001
Supplementary files








